EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30099

Zbtb44 zinc finger and BTB domain containing 44 ( MGI:1925123)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_008054_01	euxassay_008054_02	euxassay_008054_03	euxassay_008054_04	euxassay_008054_05

euxassay_008054_06	euxassay_008054_07	euxassay_008054_08	euxassay_008054_09	euxassay_008054_10

euxassay_008054_11	euxassay_008054_12	euxassay_008054_13	euxassay_008054_14	euxassay_008054_15

euxassay_008054_16	euxassay_008054_17	euxassay_008054_18	euxassay_008054_19	euxassay_008054_20

euxassay_008054_21	euxassay_008054_22	euxassay_008054_23

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T36029
Entity Detected:	Zbtb44, zinc finger and BTB domain containing 44 ( MGI:1925123)
Sequence:	sense strand is shown >T36029 CAATAGTTCCTGGGTTTGGAAGTAGTCACTGTAGAGTCAGACAGTGCTGCTGGAACCTTGCTTTGGCAGT GTCTGAACAGTGCTGCTGCTTTAACGGCTTCTGCAGCTTAGTAGTGCTCCCTCTGAGTGAGACCCAGGCC GGCTCCAGCAGACACAGGCTTCCTCTGTACACAACAAAAAACGTAGGAGTTCAGACCATGATTGAAAAAC ATTAGAATTAATGTTTTTATTAAAAATGAAAGAAAAATTAAGTTTTTAAGTGCCTAATTTATATTCTTGT TTTCTAAGTTTATTAAGCTTTGCTAAGCCTAAAAGCCCTGACTCAGTTGTGATGATTTCCTAGTAAAATC ACCAAGAATCACTTGAGGAGCTAGAGTGTCATGACTTTTACTGAATTCCTTGTTTTCTTAAATGCCAGTC TGACTACACCTAGAGGTTGACAGGTCATCCTGTGAATGAGCGTTCATTACCAAAGCGCATCGCCCACCCG CTGAGGAGTCAGCCTCTAGCTGCCCCAGGAGGGGTGGTAGTGTTGGCTTCGAGATGGGGAAGCATTTTCT GCAGTTCTGTTTTCCAGAGAGACCCTTTTCTGTGATTAGTGCGCTTCCTGTGGTTTGTCATGTTAGGTAG CAGTTCCCGGGTTGACAGCTGATATGGAAGGTCTTA
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 70412. Forward Primer - name:070412_F_cDNA_BC038156, sequence:CAATAGTTCCTGGGTTTGGAAG; Reverse Primer - name:070412_N_SP6_cDNA_BC038156, sequence:TAAGACCTTCCATATCAGCTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_008054 same experiment
	EMAGE:30071 same embryo
	EMAGE:30328 same embryo
	EMAGE:30068 same embryo
	EMAGE:30997 same embryo
	EMAGE:30994 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source