EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30568

Sema4b sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B ( MGI:107559)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_009456_01	euxassay_009456_02	euxassay_009456_03	euxassay_009456_04	euxassay_009456_05

euxassay_009456_06	euxassay_009456_07	euxassay_009456_08	euxassay_009456_09	euxassay_009456_10

euxassay_009456_11	euxassay_009456_12	euxassay_009456_13	euxassay_009456_14	euxassay_009456_15

euxassay_009456_16	euxassay_009456_17	euxassay_009456_18	euxassay_009456_19	euxassay_009456_20

euxassay_009456_21	euxassay_009456_22	euxassay_009456_23	euxassay_009456_24

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T37002
Entity Detected:	Sema4b, sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B ( MGI:107559)
Sequence:	sense strand is shown >T37002 GCAAGAATTCCTCATACAAGGCCCGGTTTCTTGTGCCAGGTAAGCCATGTAAACAAGTCCAGATCCAACC AAACACAGTGAACACCCTGGCCTGCCCACTCCTCTCAAACCTGGCCACTCGGCTCTGGGTGCACAATGGA GCCCCAGTCAATGCCTCTGCCTCCTGCCGCGTGTTACCCACCGGGGACCTGCTGCTGGTGGGCAGCCAGC AGGGTTTGGGGGTGTTCCAGTGTTGGTCGATAGAAGAAGGATTCCAGCAGCTTGTGGCCAGCTACTGCCC AGAGGTGATGGAGGAGGGGGTAATGGACCAAAAGAACCAGCGTGATGGTACCCCAGTCATTATCAACACA TCACGAGTGAGTGCACCGGCTGGTGGCAGGGCCAGCTGGGGTGCGGACAAGTCCTACTGGAATGAATTCC TGGTGATGTGTACTCTGTTTGTGTTTGCTATGGTGCTTTTGTTTCTGTTCCTTCTCTACCGACATCGGGA TGGCATGAAACTCTTCCTAAAGCAGGGCGAATGTGCCAGTGTGCACCCCAAGACTCGCCCTATAGTGCTA CCACCTGAGACCCGACCGCTGAATTGTGTCGGCCCTCCTAGCACCCCACTTGACCACCGAGGCTACCAGG CTCTGTCGGATAGCT
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 64315. Forward Primer - name:064315_F_cDNA_Sema4b, sequence:GCAAGAATTCCTCATACAAGGC; Reverse Primer - name:064315_N_SP6_cDNA_Sema4b, sequence:AGCTATCCGACAGAGCCTGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_009456 same experiment
	EMAGE:31861 same embryo
	EMAGE:31860 same embryo
	EMAGE:29434 same embryo
	EMAGE:29415 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source