Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30911

Csrp3 cysteine and glycine-rich protein 3 ( MGI:1330824)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30911 EMAGE:30911 EMAGE:30911 EMAGE:30911 EMAGE:30911
euxassay_010953_01 euxassay_010953_02 euxassay_010953_03 euxassay_010953_04 euxassay_010953_05
EMAGE:30911 EMAGE:30911 EMAGE:30911 EMAGE:30911 EMAGE:30911
euxassay_010953_06 euxassay_010953_07 euxassay_010953_08 euxassay_010953_09 euxassay_010953_10
EMAGE:30911 EMAGE:30911 EMAGE:30911 EMAGE:30911 EMAGE:30911
euxassay_010953_11 euxassay_010953_12 euxassay_010953_13 euxassay_010953_14 euxassay_010953_15
EMAGE:30911 EMAGE:30911 EMAGE:30911 EMAGE:30911 EMAGE:30911
euxassay_010953_16 euxassay_010953_17 euxassay_010953_18 euxassay_010953_19 euxassay_010953_20
EMAGE:30911 EMAGE:30911 EMAGE:30911 EMAGE:30911
euxassay_010953_21 euxassay_010953_22 euxassay_010953_23 euxassay_010953_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
heart ventricle
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20
tongue muscle
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19 20 21
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
foot
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 22 23 24
eye skeletal muscle
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 18 19 20 21 22 23 24
heart atrium
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
leg muscle
strong strong
regionalstrong expression: see section 07 09 10 11 21 22 23 moderate expression: see section 01 02 03 04 05 06 08 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06
hand
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36210
Entity Detected:Csrp3, cysteine and glycine-rich protein 3 ( MGI:1330824)
Sequence:sense strand is shown

>T36210
AGAGTCTTCACCATGCCAAACTGGGGTGGAGGTGCAAAATGTGGAGCCTGTGAAAAGACGGTCTACCATG
CAGAAGAAATCCAGTGCAATGGGAGGAGTTTCCACAAGACCTGTTTCCACTGCATGGCCTGCAGGAAAGC
TCTGGACAGCACCACAGTGGCAGCTCATGAGTCAGAGATCTACTGTAAGGTGTGCTATGGGCGCAGGTAT
GGCCCCAAGGGGATCGGGTTCGGACAAGGCGCTGGCTGCCTCAGCACAGACACTGGCGAGCATCTTGGCC
TGCAGTTCCAACAATCCCCAAAGCCAGCTCGAGCAGCCACCACAAGCAACCCTTCCAAATTCTCTGCAAA
GTTTGGAGAATCAGAGAAGTGCCCACGATGTGGAAAGTCGGTATACGCTGCTGAGAAGGTCATGGGAGGT
GGCAAGCCCTGGCACAAGACCTGCTTCCGCTGTGCCATCTGTGGGAAGAGCCTGGAGTCTACAAATGTCA
CTGACAAGGATGGGGAGCTCTACTGCAAAGTTTGCTATGCCAAAAATTTTGGCCCCACAGGCATTGGGTT
TGGAGGGCTTACACAGCAAGTGGAAAAGAAGGAGTGAAGCTGCCTGCTTTCTCACAGCCCTATCAGTCAA
CAGCAGTGCCACGTGATCCCACAGATGTAGTTTGTCCCCAACAGCCTCCTTTGTAGCTGGACAGCATTTC
TCTTCAGAAGCAGTCATAGGCTGCACCGAAGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96599. Forward Primer - name:096599_F_cDNA_Csrp3, sequence:AGAGTCTTCACCATGCCAAACT; Reverse Primer - name:096599_N_SP6_cDNA_Csrp3, sequence:ACTTCGGTGCAGCCTATGAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_010953 same experiment
 EMAGE:30913 same embryo
 EMAGE:30912 same embryo
 EMAGE:31143 same embryo
 EMAGE:31086 same embryo
 EMAGE:29359 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS