Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30912

Cthrc1 collagen triple helix repeat containing 1 ( MGI:1915838)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30912 EMAGE:30912 EMAGE:30912 EMAGE:30912 EMAGE:30912
euxassay_010954_01 euxassay_010954_02 euxassay_010954_03 euxassay_010954_04 euxassay_010954_05
EMAGE:30912 EMAGE:30912 EMAGE:30912 EMAGE:30912 EMAGE:30912
euxassay_010954_06 euxassay_010954_07 euxassay_010954_08 euxassay_010954_09 euxassay_010954_10
EMAGE:30912 EMAGE:30912 EMAGE:30912 EMAGE:30912 EMAGE:30912
euxassay_010954_11 euxassay_010954_12 euxassay_010954_13 euxassay_010954_14 euxassay_010954_15
EMAGE:30912 EMAGE:30912 EMAGE:30912 EMAGE:30912 EMAGE:30912
euxassay_010954_16 euxassay_010954_17 euxassay_010954_18 euxassay_010954_19 euxassay_010954_20
EMAGE:30912 EMAGE:30912 EMAGE:30912
euxassay_010954_21 euxassay_010954_22 euxassay_010954_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
forelimb digit 2 metacarpal
strong strong
regionalstrong expression: see section 03 04 05
radius
strong strong
regionalstrong expression: see section 01
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 03 04 05 06 23
ulna
strong strong
regionalstrong expression: see section 01
forelimb digit 3 metacarpal
strong strong
regionalstrong expression: see section 01 02
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 22 23
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 01 02 03 04
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 10 11 moderate expression: see section 12 13 19
axial skeleton
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
forelimb digit 1 metacarpal
strong strong
regionalstrong expression: see section 03 04 05
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 03 04 05 06 23
esophagus
strong strong
regionalstrong expression: see section 15 16
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
naris
strong strong
regionalstrong expression: see section 15 16 17 18 19
nasal septum
strong strong
regionalstrong expression: see section 16
cornea
strong strong
regionalstrong expression: see section 04
mandible
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 08 09 22 23
thyroid cartilage
strong strong
regionalstrong expression: see section 13 14 15 16 17
vault of skull
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
hyoid
strong strong
regionalstrong expression: see section 13 14 15 16 17
scapula
strong strong
regionalstrong expression: see section 03 04 05 22 23
maxilla
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 06 07 08 09 22
midbrain meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 05 06 07 08 09 19 20 21 22 23
clavicle
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 18 19 20 21 22
tarsus
strong strong
regionalstrong expression: see section 05 06
nose
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 18 19 20 21
otic capsule
strong strong
regionalstrong expression: see section 08 09 10 11 17 18
diaphragm
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 moderate expression: see section 03 04 05 06 07 08 09 10 11 18 19 20 21 22 23
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 19 20 21 22 23
tibia
strong strong
regionalstrong expression: see section 01 02 03 04
femur
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 08 09 20 21 22 23
heart valve
strong strong
regionalstrong expression: see section 12 13 14 15 16 17
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 10 11 12 13 14 15 19 20 21 22 23
forelimb digit 5 metacarpal
strong strong
regionalstrong expression: see section 01 02
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 05 06 23
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
stomach
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 weak expression: see section 03 04
kidney calyx
strong strong
regionalstrong expression: see section 09 10 11 12 13 19 20 21 22 23
fibula
strong strong
regionalstrong expression: see section 01 02 03 04
tongue
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19
forelimb digit 5 phalanx
strong strong
regionalstrong expression: see section 01 02
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 04 05 06 07 20 21 22 23
midgut
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 21
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
basioccipital bone
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
basisphenoid bone
strong strong
regionalstrong expression: see section 01 12 13 14 15 16 17 18 19 20
hand mesenchyme
strong strong
regionalstrong expression: see section 01
forelimb digit 4 metacarpal
strong strong
regionalstrong expression: see section 01 02
forelimb digit 4 phalanx
strong strong
regionalstrong expression: see section 01 02
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36213
Entity Detected:Cthrc1, collagen triple helix repeat containing 1 ( MGI:1915838)
Sequence:sense strand is shown

>T36213
CTGGACCCCAAACTATAAGCAGTGTTCGTGGAGTTCGCTGAACTATGGCATAGATCTTGGGAAAATTGCG
GAGTGTACATTCACGAAGATGCGCTCCAACAGTGCTCTGCGAGTTCTGTTCAGTGGCTCGCTTCGGCTCA
AATGCAGGAATGCATGCTGTCAGCGCTGGTATTTTACATTTAATGGAGCTGAATGTTCAGGACCTCTTCC
CATCGAAGCCATCATCTATCTGGACCAAGGAAGCCCTGAGTTAAATTCAACTATTAATATTCATCGTACT
TCCTCTGTGGAAGGACTCTGTGAAGGGATTGGTGCTGGATTGGTAGATGTGGCCATCTGGGTCGGCACCT
GTTCAGATTACCCCAAAGGAGACGCTTCTACTGGATGGAATTCCGTGTCTCGCATCATCATTGAAGAACT
ACCGAAATAAAGCCTCTGACGATTTCAGTCCCTGCCTCGTTGGCTTTTTAAATCAAGCCCTTGAATGGTT
CATTTAAATGACATTTAAGAAATCACTTAAATGAAGTGCTCAGCTGAATGAAAAAGCAAAGTTAAATATG
TTTACAGACCAAAGTGTGATCTCACA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 85001. Forward Primer - name:085001_F_cDNA_Cthrc1, sequence:CTGGACCCCAAACTATAAGCAG; Reverse Primer - name:085001_N_SP6_cDNA_Cthrc1, sequence:TGTGAGATCACACTTTGGTCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_010954 same experiment
 EMAGE:30913 same embryo
 EMAGE:30911 same embryo
 EMAGE:31143 same embryo
 EMAGE:31086 same embryo
 EMAGE:29359 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS