Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30915

Abce1 ( MGI:1195458)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30915 EMAGE:30915 EMAGE:30915 EMAGE:30915 EMAGE:30915
euxassay_006203_01 euxassay_006203_02 euxassay_006203_03 euxassay_006203_04 euxassay_006203_05
EMAGE:30915 EMAGE:30915 EMAGE:30915 EMAGE:30915 EMAGE:30915
euxassay_006203_06 euxassay_006203_07 euxassay_006203_08 euxassay_006203_09 euxassay_006203_10
EMAGE:30915 EMAGE:30915 EMAGE:30915 EMAGE:30915 EMAGE:30915
euxassay_006203_11 euxassay_006203_12 euxassay_006203_13 euxassay_006203_14 euxassay_006203_15
EMAGE:30915 EMAGE:30915 EMAGE:30915 EMAGE:30915 EMAGE:30915
euxassay_006203_16 euxassay_006203_17 euxassay_006203_18 euxassay_006203_19 euxassay_006203_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 07 13
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 10 11 12 13 14 15 16 17 18 19 20
thymus primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20
midbrain ventricular layer
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 12 16 17
frontal bone primordium
moderate moderate
regionalmoderate expression: see section 01 02 03 04
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 weak expression: see section 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T615
Entity Detected:Abce1, ( MGI:1195458)
Sequence:sense strand is shown

>T615
GTTGGCCTACTGGGTTTAAGGCTGCCATTACGATTCGATCTCTAATAAATCCAGATAGATATATCATTGT
GGTGGAGCATGATCTAAGTGTATTAGACTATCTCTCTGACTTCATCTGCTGTCTATATGGGGTACCGAGT
GCTTATGGTGTTGTCACGATGCCTTTTAGTGTAAGAGAAGGCATAAATATATTTTTGGATGGCTATGTTC
CAACAGAGAACCTGAGGTTCAGGGATGCGTCGCTTGTTTTTAAGGTAGCTGAGACAGCAAATGAAGAAGA
AGTTAAAAAGATGTGCATGTATAAATATCCCGGGATGAAGAAAAAGATGGGAGAGTTCGAGCTAGCAATT
GTAGCTGGAGAGTTCACGGACTCTGAGATCATGGTGATGCTGGGGGAGAATGGTACAGGTAAAACTACAT
TTATCAGAATGCTTGCTGGAAGGCTTAAACCAGATGAAGGAGGAGAAGTGCCAGTTCTAAATGTCAGTTA
TAAGCCACAGAAAATCAGTCCCAAATCAACAGGAAGTGTTCGCCAGTTACTGCATGAAAAGA
Notes:The probe template was PCR amplified from IMAGE:1886091 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1886091 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006203 same experiment
 EMAGE:31791 same embryo
 EMAGE:30805 same embryo
 EMAGE:31810 same embryo
 EMAGE:31776 same embryo
 EMAGE:30874 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS