Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30989

Dclk1 doublecortin-like kinase 1 ( MGI:1330861)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30989 EMAGE:30989 EMAGE:30989 EMAGE:30989 EMAGE:30989
euxassay_012542_01 euxassay_012542_02 euxassay_012542_03 euxassay_012542_04 euxassay_012542_05
EMAGE:30989 EMAGE:30989 EMAGE:30989 EMAGE:30989 EMAGE:30989
euxassay_012542_06 euxassay_012542_07 euxassay_012542_08 euxassay_012542_09 euxassay_012542_10
EMAGE:30989 EMAGE:30989 EMAGE:30989 EMAGE:30989 EMAGE:30989
euxassay_012542_11 euxassay_012542_12 euxassay_012542_13 euxassay_012542_14 euxassay_012542_15
EMAGE:30989 EMAGE:30989 EMAGE:30989 EMAGE:30989 EMAGE:30989
euxassay_012542_16 euxassay_012542_17 euxassay_012542_18 euxassay_012542_19 euxassay_012542_20
EMAGE:30989 EMAGE:30989 EMAGE:30989
euxassay_012542_21 euxassay_012542_22 euxassay_012542_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 15 16
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 14 15 16
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 15 16 17 18
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 12
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 11 13 14 15
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 11 13
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 12
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 13 14 15 16 17
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 13 14 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 17
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31388
Entity Detected:Dclk1, doublecortin-like kinase 1 ( MGI:1330861)
Sequence:sense strand is shown

>T31388
CAAGGGTGCCGACATTTTCTACTCGCGGTATTCTTTGAAAGAAAAAAAAATTTTTTTTAAAGTATCTCCT
CCATTTGATGTAACCGAGGAGAGTTTGAATACAATATTTGTTAGTCGCTGAGGATTTTATGACTAAAGTC
TTGTTCCAGATAAATTTCATATATGACTCCAATATTAACTACAAGAACCACCCTAATGATCCAGCATTAC
AGAGTCACCATTTCTGTAAATGAGTCTTCTTTTTAATCAGTAAGTAGATAGATATATAAATACAATTTTT
CTGTACTTAGTATAAGGGAAATTTAATAAAGTAACAGACACGGTTTTTCTAAAAGGTAAAAATCTTCTAC
CTTTTTAATTTAAAAGTTAAAAATAGTCAGACAGCTGACTAGCTTTTTCATTGCAAAATAATACAAAAAC
TCTTGAGGATTTTTTTTTTTTTTGAGTGACTATGTCTGGAAGGGAATTGAGGGACTTCTGTAGGAGACAT
CTCACAAAGACTAACATTAAACAGTAAGAAAATTCTCTGGGTTTTTGTTTTTGCTGTTGTTGTCGTCATG
CG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5006471), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 62589. Forward Primer - name:062589_F_IRAV55-58_I18_Dcamkl1, sequence:CAAGGGTGCCGACATTTT; Reverse Primer - name:062589_R_SP6_IRAV55-58_I18_Dcamkl1, sequence:CCGCATGACGACAACAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012542 same experiment
 EMAGE:32064 same embryo
 EMAGE:30092 same embryo
 EMAGE:30073 same embryo
 EMAGE:30693 same embryo
 EMAGE:32069 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS