Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31084

Abca3 ( MGI:1351617)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31084 EMAGE:31084 EMAGE:31084 EMAGE:31084 EMAGE:31084
euxassay_009339_01 euxassay_009339_02 euxassay_009339_03 euxassay_009339_04 euxassay_009339_05
EMAGE:31084 EMAGE:31084 EMAGE:31084 EMAGE:31084 EMAGE:31084
euxassay_009339_06 euxassay_009339_07 euxassay_009339_08 euxassay_009339_09 euxassay_009339_10
EMAGE:31084 EMAGE:31084 EMAGE:31084 EMAGE:31084 EMAGE:31084
euxassay_009339_11 euxassay_009339_12 euxassay_009339_13 euxassay_009339_14 euxassay_009339_15
EMAGE:31084 EMAGE:31084 EMAGE:31084 EMAGE:31084 EMAGE:31084
euxassay_009339_16 euxassay_009339_17 euxassay_009339_18 euxassay_009339_19 euxassay_009339_20
EMAGE:31084 EMAGE:31084 EMAGE:31084
euxassay_009339_21 euxassay_009339_22 euxassay_009339_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 22 weak expression: see section 01 02 03 04
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 15 moderate expression: see section 05 06 weak expression: see section 07
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 06 07 12
spinal cord
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11
brain
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 15 16
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 15 16
thoracic ganglion
weak weak
regionalweak expression: see section 08 10
retina
moderate moderate
regionalmoderate expression: see section 23
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 06 17 18 19
vagus x ganglion
strong strong
regionalstrong expression: see section 05 06 14 15
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 15 16 17 18 19 moderate expression: see section 20
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 12 14 15 16 weak expression: see section 09 10 11 17 18
cervical ganglion
weak weak
regionalweak expression: see section 06 07 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35857
Entity Detected:Abca3, ( MGI:1351617)
Sequence:sense strand is shown

>T35857
GAGAACTATGAGACTCGGCGATACTGCACTTCCTCAGAGCTTGCTGCCCACTACTGCAAGAAGTACAACA
TCCAGTACCAGGAGAGCTTCTATGCCTGGAGCACCCCAGGCGTGGGCAAGTTTGTGACTTCCATGGCTGC
CTCAGGGGGCATCTATCTCACCCTGCTGTTCCTCATTGAGACCAACCTGCTGTGGCGACTGAGAACCTTC
ATCTGTGCCTTCCGGAGGAGGTGGACTCTGGCAGAACTGCAGAACCGGACATCAGTGCTGCCCGAGGACC
AGGATGTAGCTGAGGAGAGGAGCCGAATCCTGGTCCCTAGCTTGGACTCCATGCTCGACACACCACTGAT
TATCAACGAGCTCTCCAAGGTGTATGACCAGCGAGCACCGCTCCTTGCCGTGGACAGGATCTCCCTTGCG
GTCCAGAAAGGGGAGTGCTTCGGCCTGTTGGGTTTCAATGGAGCTGGAAAAACCACAACATTCAAAATGC
TGACTGGGGAGGAGACCATCACCTCAGGGGACGCCTTTGTTGGTGGTTACAGCATCAGTTCTGACATTGG
GAAGGTGCGGCAGCGGATGGGCTACTGCCCCCAGTTTGATGCACTGCTTGATCACATGACTGGCAGGGAG
ATGCTGGTTATGTATGCACGGCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90646. Forward Primer - name:090646_F_cDNA_Abca3, sequence:GAGAACTATGAGACTCGGCGAT; Reverse Primer - name:090646_N_SP6_cDNA_Abca3, sequence:GAGCCGTGCATACATAACCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009339 same experiment
 EMAGE:30822 same embryo
 EMAGE:30992 same embryo
 EMAGE:29961 same embryo
 EMAGE:30995 same embryo
 EMAGE:30147 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS