Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31108

Rpl35a ( MGI:1917375)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31108 EMAGE:31108 EMAGE:31108 EMAGE:31108 EMAGE:31108
euxassay_000501_01 euxassay_000501_02 euxassay_000501_03 euxassay_000501_04 euxassay_000501_05
EMAGE:31108 EMAGE:31108 EMAGE:31108 EMAGE:31108 EMAGE:31108
euxassay_000501_06 euxassay_000501_07 euxassay_000501_08 euxassay_000501_09 euxassay_000501_10
EMAGE:31108 EMAGE:31108 EMAGE:31108 EMAGE:31108 EMAGE:31108
euxassay_000501_11 euxassay_000501_12 euxassay_000501_13 euxassay_000501_14 euxassay_000501_15
EMAGE:31108 EMAGE:31108 EMAGE:31108 EMAGE:31108 EMAGE:31108
euxassay_000501_16 euxassay_000501_17 euxassay_000501_18 euxassay_000501_19 euxassay_000501_20
EMAGE:31108 EMAGE:31108 EMAGE:31108 EMAGE:31108
euxassay_000501_21 euxassay_000501_22 euxassay_000501_23 euxassay_000501_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
inner ear vestibular component
strong strong
regionalstrong expression: see section 20 weak expression: see section 15
sphenoid bone
strong strong
homogeneousstrong expression: see section 20
glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 17 18
otic capsule
strong strong
regionalstrong expression: see section 20 weak expression: see section 15
pancreas
strong strong
regionalstrong expression: see section 23 24
submandibular gland primordium
strong strong
regionalstrong expression: see section 18 19 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 18
basisphenoid bone
strong strong
homogeneousstrong expression: see section 19 20 moderate expression: see section 16
thymus primordium
moderate moderate
regionalmoderate expression: see section 23 weak expression: see section 24
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 14 moderate expression: see section 18 weak expression: see section 17
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 09 10 11 13 14 16 17 18 19 21 22 23 24
midbrain ventricular layer
strong strong
homogeneousstrong expression: see section 21 22 23 24
telencephalon mantle layer
strong strong
homogeneousstrong expression: see section 09 10
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2329
Entity Detected:Rpl35a, ( MGI:1917375)
Sequence:sense strand is shown

>T2329
TGGCCTCGAGCCAGATTCGGATCCTTCGGCGCCTGTGGAGGCCTGCTGGGAACAGGACTTCTAACAGCAA
GTATGTCTGGAAGGCTGTGGTGCAAGGCCATTTTTGCTGGCTACAAGCGAGGTCTCCGGAACCAAAGAGA
GCACACGGCTCTTCTTAAAATTGAAGGCGTTTATGCCCGAGATGAAACGGAGTTCTACTTAGGCAAGAGA
TGTGCTTATGTGTATAAAGCAAAAAACAATACAGTGACTCCTGGAGGTAAACCAAACAAAACCAGAGTGA
TCTGGGGAAAGGNAACTCGGGCCCACGGAAACAGCGGTATGGTTCGTGCCAAATTCCGAAGCAACCTTCC
TGCAAAGGCCATTGGACACAGAATCCGTGTGATGCTGTACCCATCCCGGATTTAAACTAATGGAGAGTAA
ATAAATAAAAGTAGATTTGTAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1165021 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1165021 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000501 same experiment
 EMAGE:31107 same assay
 EMAGE:30281 same embryo
 EMAGE:30284 same embryo
 EMAGE:30300 same embryo
 EMAGE:31107 same embryo
 EMAGE:29647 same embryo
 EMAGE:30312 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS