Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31131

Vkorc1 ( MGI:106442)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31131 EMAGE:31131 EMAGE:31131 EMAGE:31131 EMAGE:31131
euxassay_000753_01 euxassay_000753_02 euxassay_000753_03 euxassay_000753_04 euxassay_000753_05
EMAGE:31131 EMAGE:31131 EMAGE:31131 EMAGE:31131 EMAGE:31131
euxassay_000753_06 euxassay_000753_07 euxassay_000753_08 euxassay_000753_09 euxassay_000753_10
EMAGE:31131 EMAGE:31131 EMAGE:31131 EMAGE:31131 EMAGE:31131
euxassay_000753_11 euxassay_000753_12 euxassay_000753_13 euxassay_000753_14 euxassay_000753_15
EMAGE:31131 EMAGE:31131 EMAGE:31131 EMAGE:31131 EMAGE:31131
euxassay_000753_16 euxassay_000753_17 euxassay_000753_18 euxassay_000753_19 euxassay_000753_20
EMAGE:31131 EMAGE:31131 EMAGE:31131 EMAGE:31131
euxassay_000753_21 euxassay_000753_22 euxassay_000753_23 euxassay_000753_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
meckel's cartilage
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 19 20 21 22 23 24
upper jaw molar
weak weak
regionalweak expression: see section 07 08 09 10 11 19 20 21 22 23 24
upper jaw incisor
weak weak
regionalweak expression: see section 09 10 11 12 13 14 17 18 19 20 21
chondrocranium
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 weak expression: see section 21 22 23 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1021
Entity Detected:Vkorc1, ( MGI:106442)
Sequence:sense strand is shown

>T1021
TCTCAGNCTGTTGGCCTACTGGTTCTTCCCTCCTGTCCCTGGGCTGTACTGTCGACATGGGCACCACCTG
GAGGAGCCCTGGACTCGTGCGGCTTGCACTGTGCCTCGCTGGCTTAGCCCTCTCACTGTACGCACTGCAC
GTGAAGGCGGCGCGCGCCCGCGATGAAAATTACCGCGCGCTCTGCGATGTGGGCACGGCCATCAGCTGTT
CCCGCGTCTTCTCCTCTCGGTGGGGCCGGGGCTTTGGGCTGGTGGAGCACATGCTAGGAGCGGACAGCGT
CCTCAACCAATCCAACAGCATATTTGGTTGCCTGTTCTACACCTTACAGCTGTTGTTAGGTTGCTTGAGG
GGACGTTGGGCCTCTATCCTACTGGTGCTGAGTTCCCTGGTGTCCGTCGCTGGTTCCGTGTACCTGGCCT
GGATCCTGTTCTTTGTGTTATATGATTTCTGCATTGTGTGCATTACCACCTATGCCATCAATGTGGGTCT
GATGTTGCTTAGCTTCCAGAAGGTACCAGAACACAAGACCAAAAAGCACTGA
Notes:The probe template was PCR amplified from IMAGE:2076623 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2076623 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000753 same experiment
 EMAGE:31112 same embryo
 EMAGE:31133 same embryo
 EMAGE:31129 same embryo
 EMAGE:31116 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS