Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31144

Gnai2 guanine nucleotide binding protein (G protein), alpha inhibiting 2 ( MGI:95772)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31144 EMAGE:31144 EMAGE:31144 EMAGE:31144 EMAGE:31144
euxassay_011632_01 euxassay_011632_02 euxassay_011632_03 euxassay_011632_04 euxassay_011632_05
EMAGE:31144 EMAGE:31144 EMAGE:31144 EMAGE:31144 EMAGE:31144
euxassay_011632_06 euxassay_011632_07 euxassay_011632_08 euxassay_011632_09 euxassay_011632_10
EMAGE:31144 EMAGE:31144 EMAGE:31144 EMAGE:31144 EMAGE:31144
euxassay_011632_11 euxassay_011632_12 euxassay_011632_13 euxassay_011632_14 euxassay_011632_15
EMAGE:31144 EMAGE:31144 EMAGE:31144 EMAGE:31144 EMAGE:31144
euxassay_011632_16 euxassay_011632_17 euxassay_011632_18 euxassay_011632_19 euxassay_011632_20
EMAGE:31144 EMAGE:31144
euxassay_011632_21 euxassay_011632_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 08 16 17 18 19 moderate expression: see section 09
vibrissa
strong strong
regionalstrong expression: see section 05 06 08 17 18 19 20
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22
midbrain ventricular layer
strong strong
homogeneousstrong expression: see section 08 09 10 11 12 13 14 15 16 17
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 08 09 10 14 15
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
pons ventricular layer
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
rest of cerebellum ventricular layer
strong strong
homogeneousstrong expression: see section 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31688
Entity Detected:Gnai2, guanine nucleotide binding protein (G protein), alpha inhibiting 2 ( MGI:95772)
Sequence:sense strand is shown

>T31688
GGGCCAACAAGTACGACGAGGCAGCCAGCTACATCCAGAGCAAGTTTGAGGATCTAAATAAGCGCAAAGA
CACCAAGGAGATCTACACGCACTTCACGTGCGCCACCGACACCAAGAACGTGCAGTTTGTGTTCGATGCC
GTCACTGACGTCATCATCAAGAACAACCTGAAGGACTGTGGCCTCTTCTGAGGGGCAGTGGACCTGGCAG
GATGGGCCACCGCTGACTGTGCTCCCCACTACCCCTGAGGAAGATGGGGGCAAGAAGACCATGTTCCCTG
CCTGTTCCCCCAGCTGCTTCTCCCATCTTTTCTCTCTGTTCTCAGCTCCCCTGTCCCCTCCCTCGGCTCT
AGACTTGGGGGAGGGGTTGCCACAGGCCTCCCAGTCTAAAACCCACCTTTGTCTGAGGTGCCGGGAGTAG
CCATGGTACCCCCTTCCTGGGCATCCGTTCGGGTTTTCTAACCGTTGTCTTGTTCTGGGGTGAGCGGGGA
GCGCATGCAGAGATCCCAAGGCCTATGTCTGGAGGGTACCAACTCCTCCAGCCTAGACCCCTGGCTTTGT
CCAACACCAGCCCTGACCCAAGTCCAAATGTTTACAGGGAGCCTCCTGCCTACCCCACTCTCTGCCGCTC
GGAGGCCCCAAAGGAAAAAGCACAAGAAGCGTGAGAGATACCGCCATTCCTGGAGACAAAGCCCACCTGC
CTACCCCACTCTCTGCCGCTCGGAGGCCCCAAAGGAAAAAGCACAAGAAGCGTGAGAGATACCGCCATTC
CTGGAGACAAAGCCCACCTGCTCATTCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4912684), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 37761. Forward Primer - name:037761_F_IRAV81-84_H09_Gnai2, sequence:GGGCCAACAAGTACGACG; Reverse Primer - name:037761_R_SP6_IRAV81-84_H09_Gnai2, sequence:CGAGAATGAGCAGGTGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011632 same experiment
 EMAGE:29979 same embryo
 EMAGE:30812 same embryo
 EMAGE:30810 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS