Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31165

Krt13 ( MGI:101925)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31165 EMAGE:31165 EMAGE:31165 EMAGE:31165 EMAGE:31165
euxassay_012274_01 euxassay_012274_02 euxassay_012274_03 euxassay_012274_04 euxassay_012274_05
EMAGE:31165 EMAGE:31165 EMAGE:31165 EMAGE:31165 EMAGE:31165
euxassay_012274_06 euxassay_012274_07 euxassay_012274_08 euxassay_012274_09 euxassay_012274_10
EMAGE:31165 EMAGE:31165 EMAGE:31165 EMAGE:31165 EMAGE:31165
euxassay_012274_11 euxassay_012274_12 euxassay_012274_13 euxassay_012274_14 euxassay_012274_15
EMAGE:31165 EMAGE:31165 EMAGE:31165 EMAGE:31165 EMAGE:31165
euxassay_012274_16 euxassay_012274_17 euxassay_012274_18 euxassay_012274_19 euxassay_012274_20
EMAGE:31165 EMAGE:31165
euxassay_012274_21 euxassay_012274_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
oral epithelium
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
cornea epithelium
strong strong
regionalstrong expression: see section 01 02 19 20 21 22
larynx
strong strong
regionalstrong expression: see section 11 12 13
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 weak expression: see section 07
rectum
strong strong
regionalstrong expression: see section 09
urethra of male
strong strong
regionalstrong expression: see section 09 10
sublingual gland primordium
weak weak
regionalweak expression: see section 08 09 14 15
midgut
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14
bladder
strong strong
regionalstrong expression: see section 09 10 11
esophagus
strong strong
regionalstrong expression: see section 11 12 13 weak expression: see section 14 15
lower jaw molar
strong strong
regionalstrong expression: see section 05 17 18
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 15 16 17
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 05 16 17 18 21 22 moderate expression: see section 06 07 19 20
upper jaw molar
strong strong
regionalstrong expression: see section 05 17 18
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 14 weak expression: see section 13
vibrissa
strong strong
regionalstrong expression: see section 02 03 04 16 17 18 19 20
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 13 14 15 weak expression: see section 06 07
hindgut
weak weak
regionalweak expression: see section 09 10 11
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
naris
strong strong
regionalstrong expression: see section 08 09 11 12 moderate expression: see section 13
lower jaw incisor
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14
upper jaw incisor
strong strong
regionalstrong expression: see section 08 09 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30422
Entity Detected:Krt13, ( MGI:101925)
Sequence:sense strand is shown

>T30422
TTCGGAGGTGTCGATGGTGGCCTCCTCTCTGGCAACGAGAAGATCACCATGCAGAACCTCAATGACCGCC
TGGCCAGCTACCTGGATAAGGTGCGCGCCTTGGAGGCAGCCAATGCCGACCTGGAGGTGAAGATTCGTGA
CTGGCATCTGAAACAGAGCCCAGCTAGTCCAGAGCGGGACTACAGTGCTTATTATAAGACCATCGAGGAG
CTCCGGATCAAGATTCTGGAAGCCACCACGGACAACAACCGGATCATCCTGGAGATTGACAATGCCAGGC
TGGCTGCAGATGACTTCAGGCTCAAGTACGAAAATGAGCTGACCTTGCGCCAGAGCGTGGAGGCCGACAT
CAACGGCCTGCGCAGGGTGCTGGATGAGCTGACTCTGGCTAAGACTGACCTGGAAATGCAGATTGAGAGC
CTGAATGAAGAACTGGCTTACCTGAAGAAGAACCACGAAGAGGAGATGAAGGAATTCAGCAACCAGGTAG
TAGGCCAGGTCAATGTGGAGATGGACGCCACCCCTGGCATTGATCTGACCCGTGTGCTGGCTGAGATGAG
GGAGCAGTATGAAGCCCTGGCAGAGAAGAATCGGAGGGATGCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:30292772), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60437. Forward Primer - name:060437_F_IRAV104_e12_Krt1-13, sequence:TTCGGAGGTGTCGATGGT; Reverse Primer - name:060437_R_SP6_IRAV104_e12_Krt1-13, sequence:TCAGCATCCCTCCGATT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012274 same experiment
 EMAGE:31095 same embryo
 EMAGE:29388 same embryo
 EMAGE:31189 same embryo
 EMAGE:31167 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS