Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31181

Tnnt2 troponin T2, cardiac ( MGI:104597)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31181 EMAGE:31181 EMAGE:31181 EMAGE:31181 EMAGE:31181
euxassay_000294_01 euxassay_000294_02 euxassay_000294_03 euxassay_000294_04 euxassay_000294_05
EMAGE:31181 EMAGE:31181 EMAGE:31181 EMAGE:31181 EMAGE:31181
euxassay_000294_06 euxassay_000294_07 euxassay_000294_08 euxassay_000294_09 euxassay_000294_10
EMAGE:31181 EMAGE:31181 EMAGE:31181 EMAGE:31181 EMAGE:31181
euxassay_000294_11 euxassay_000294_12 euxassay_000294_13 euxassay_000294_14 euxassay_000294_15
EMAGE:31181 EMAGE:31181 EMAGE:31181 EMAGE:31181 EMAGE:31181
euxassay_000294_16 euxassay_000294_17 euxassay_000294_18 euxassay_000294_19 euxassay_000294_20
EMAGE:31181 EMAGE:31181
euxassay_000294_21 euxassay_000294_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
right atrium cardiac muscle
strong strong
regionalstrong expression: see section 05 06 07 08 09 11 12 13 14 15 16
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22
tail mesenchyme
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
left atrium cardiac muscle
strong strong
regionalstrong expression: see section 05 06 07 08 09 11 12 13 14 15 16
heart ventricle
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13
tongue
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3683
Entity Detected:Tnnt2, troponin T2, cardiac ( MGI:104597)
Sequence:sense strand is shown

>T3683
TGGCCTCGAGCCAGATTCGGCACGAGGGGAAGAGACAGACAGAGAGAGAGAAGAAGAAGAAGATCCTGGC
AGAGAGGAGGAAGGCGCTGGCCATCGACCACCTGAATGAAGACCAACTGAGAGAGAAGGCCAAGGAGCTG
TGGCAGAGTATTCACAACCTGGAGGCTGAGAAGTTCGACCTGCAGGAAAAGTTCAAGCAGCAGAAATACG
AAATCAACGTTCTGCGAAACCGGATCAATGACAACCAGAAAGTCTCCAAAACTCGTGGGAAGGCCAAAGT
CACCGGGCGTTGGAAATAGATGAAACTGTTCTCGTCAAAGCTGTGCCCCCTGCTTGTGTCCTTGCCCCGT
GCATCCCAGCTCTGGGTCCTCCTTGGCACCCAATGCAGACTCCTGTTTGGATAGTGGGAGCTGGCTTAGC
TAGAAGCCAGTACTCTGCCTGACCCCTATGCCCGCACTATGCCAGCAATAAAAAGCCAACACACTGCAAA
AAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:353389 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:353389 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000294 same experiment
 EMAGE:29381 same embryo
 EMAGE:29850 same embryo
 EMAGE:29379 same embryo
 EMAGE:29411 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS