Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31197

Lypla2 ( MGI:1347000)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31197 EMAGE:31197 EMAGE:31197 EMAGE:31197 EMAGE:31197
euxassay_000279_01 euxassay_000279_02 euxassay_000279_03 euxassay_000279_04 euxassay_000279_05
EMAGE:31197 EMAGE:31197 EMAGE:31197 EMAGE:31197 EMAGE:31197
euxassay_000279_06 euxassay_000279_07 euxassay_000279_08 euxassay_000279_09 euxassay_000279_10
EMAGE:31197 EMAGE:31197 EMAGE:31197 EMAGE:31197 EMAGE:31197
euxassay_000279_11 euxassay_000279_12 euxassay_000279_13 euxassay_000279_14 euxassay_000279_15
EMAGE:31197 EMAGE:31197 EMAGE:31197 EMAGE:31197 EMAGE:31197
euxassay_000279_16 euxassay_000279_17 euxassay_000279_18 euxassay_000279_19 euxassay_000279_20
EMAGE:31197 EMAGE:31197 EMAGE:31197 EMAGE:31197
euxassay_000279_21 euxassay_000279_22 euxassay_000279_23 euxassay_000279_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 05 06 07 08 17 18 19 20 21 22
tail dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 17 18 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3631
Entity Detected:Lypla2, ( MGI:1347000)
Sequence:sense strand is shown

>T3631
CTTCCCACCCTATCCTCTTCCCACAGGCCTCTGGGGCAGGTCGCCGAGGCTGGCCAGGCCTTCTTGCTGG
CCTTGGCCATCTGGAAGTCAGCAGCGGGGTGGGCTGCTCTCTTATCCTGCGTCCCCAGAGGCGGGCCCCA
GCAGCAGTATTGGAGGGGCTGTAGGCGGCGGGAGGAAGGGGCCCAGCTGCTGACCCGCTCACTCAGGACC
TCACCCACTAGCCCCGCTTTGGGCCCCCTCCCGTGACCTCAGGGTTTGGCCCGTGGGGCCCTCGTGGGCC
CCTCCCCCCATGACTCTGCCCGGATAATCGTCTCTCCTGCCTCGCTGCAGCCGCTTCTGTCACGAATGTG
TCCATGGCCCGGGGCCCTTGCTGCTGTGGGCTGCCTGCTCCAGGACAGGCTGGCCAGTGAGGAGGTAGAG
TCCCTCGGGGCCTCCCCTCAGCCCCTCCCCGAGAGGGGCTGGACCCTGCCTCCCCATGGCCCTTCCTTGC
AGGCCTGGAGCCTGCAGGGCTGGATTGAGGTTCAAGGGCCCCCCCAACTCC
Notes:The probe template was PCR amplified from IMAGE:3168043 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3168043 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000279 same experiment
 EMAGE:30087 same embryo
 EMAGE:31195 same embryo
 EMAGE:29401 same embryo
 EMAGE:29302 same embryo
 EMAGE:31215 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS