Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31224

Akr1c6 ( MGI:1933427)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31224 EMAGE:31224 EMAGE:31224 EMAGE:31224 EMAGE:31224
euxassay_000002_01 euxassay_000002_02 euxassay_000002_03 euxassay_000002_04 euxassay_000002_05
EMAGE:31224 EMAGE:31224 EMAGE:31224 EMAGE:31224 EMAGE:31224
euxassay_000002_06 euxassay_000002_07 euxassay_000002_08 euxassay_000002_09 euxassay_000002_10
EMAGE:31224 EMAGE:31224 EMAGE:31224 EMAGE:31224 EMAGE:31224
euxassay_000002_11 euxassay_000002_12 euxassay_000002_13 euxassay_000002_14 euxassay_000002_15
EMAGE:31224 EMAGE:31224 EMAGE:31224 EMAGE:31224 EMAGE:31224
euxassay_000002_16 euxassay_000002_17 euxassay_000002_18 euxassay_000002_19 euxassay_000002_20
EMAGE:31224 EMAGE:31224 EMAGE:31224
euxassay_000002_21 euxassay_000002_22 euxassay_000002_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
saccule
weak weak
regionalweak expression: see section 03 05
stomach fundus lumen
strong strong
regionalstrong expression: see section 06 07
stomach glandular region lumen
strong strong
homogeneousstrong expression: see section 06 07
utricle
weak weak
regionalweak expression: see section 17
metanephros
strong strong
homogeneousstrong expression: see section 08
not examined not examined
othernot examined expression: see section 11
liver and biliary system
weak weak
spottedweak expression: see section 07
stomach proventricular region lumen
strong strong
homogeneousstrong expression: see section 06 07 moderate expression: see section 05
foregut-midgut junction duodenum
strong strong
regionalstrong expression: see section 07 08 09 11
foregut-midgut junction lumen
strong strong
homogeneousstrong expression: see section 11
not examined not examined
othernot examined expression: see section 07
thymus primordium
strong strong
homogeneousstrong expression: see section 10 11 12 13
cochlear duct epithelium
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 14
nasal cavity respiratory epithelium
strong strong
regionalstrong expression: see section 13 moderate expression: see section 07 08 09 17 weak expression: see section 05 11 12
vibrissa
weak weak
spottedweak expression: see section 06
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 13 17 weak expression: see section 05 11 12 18 19
nasal cavity epithelium
moderate moderate
regionalmoderate expression: see section 07 16
nasal septum
moderate moderate
regionalmoderate expression: see section 06
middle ear mesenchyme
moderate moderate
regionalmoderate expression: see section 20 21 weak expression: see section 19
middle ear
moderate moderate
regionalmoderate expression: see section 01 20
vibrissa dermal component
moderate moderate
homogeneousmoderate expression: see section 20 weak expression: see section 06 21
outer ear
moderate moderate
regionalmoderate expression: see section 01
meckel's cartilage
moderate moderate
homogeneousmoderate expression: see section 07 weak expression: see section 06
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 11 14 16 17 weak expression: see section 08 12 13 15 18 19
physiological umbilical hernia
strong strong
homogeneousstrong expression: see section 09 13
physiological umbilical hernia dermis
strong strong
homogeneousstrong expression: see section 09 11 12 moderate expression: see section 13
duodenum caudal part
strong strong
regionalstrong expression: see section 10
midgut duodenum
strong strong
regionalstrong expression: see section 10
oral region
moderate moderate
homogeneousmoderate expression: see section 05 not examined expression: see section 11
hemolymphoid system
strong strong
spottedstrong expression: see section 13
cochlear duct mesenchyme
weak weak
homogeneousweak expression: see section 14
sublingual gland primordium
moderate moderate
regionalmoderate expression: see section 09
cochlear duct
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 14 16
nose
moderate moderate
regionalmoderate expression: see section 09
salivary gland
weak weak
homogeneousweak expression: see section 06
pancreas
moderate moderate
homogeneousmoderate expression: see section 10 weak expression: see section 07
right lung caudal lobe lobar bronchus
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 04
lateral semicircular canal
weak weak
regionalweak expression: see section 17
right lung caudal lobe
weak weak
spottedweak expression: see section 06
extraembryonic vascular system
strong strong
regionalstrong expression: see section 10
duodenum caudal part lumen
strong strong
regionalstrong expression: see section 10
liver right lobe
weak weak
spottedweak expression: see section 14 17
right lung
strong strong
spottedstrong expression: see section 12 13 14 15 16 17 18 moderate expression: see section 19 20 weak expression: see section 06
left lung vascular element
moderate moderate
spottedmoderate expression: see section 09
stomach
strong strong
gradedstrong expression: see section 06 07 moderate expression: see section 05
umbilical artery extraembryonic part
strong strong
regionalstrong expression: see section 10
right lung accessory lobe lobar bronchus
strong strong
spottedstrong expression: see section 12
umbilical vein extraembryonic part
strong strong
regionalstrong expression: see section 10
left lung lobar bronchus
strong strong
spottedstrong expression: see section 08 moderate expression: see section 04 09 not examined expression: see section 05
gland
strong strong
regionalstrong expression: see section 10
respiratory system
moderate moderate
spottedmoderate expression: see section 04
adrenal gland
strong strong
homogeneousstrong expression: see section 08 09 moderate expression: see section 17 not examined expression: see section 10
labyrinth
weak weak
regionalweak expression: see section 04
liver
weak weak
homogeneousweak expression: see section 05 07 10 11 13 15 16 18 20
liver lobe
moderate moderate
spottedmoderate expression: see section 09 weak expression: see section 08
liver left lobe
weak weak
spottedweak expression: see section 17
lung
strong strong
spottedstrong expression: see section 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1487
Entity Detected:Akr1c6, ( MGI:1933427)
Sequence:sense strand is shown

>T1487
GNCTGTTGGCCTACTGGGGATTCTAANCAGCAGACAGTGCGTCTAAGTGATGGTCACTTCATCCCTATAC
TGGGGTTTGGTACCTATGCACCTCAAGAGGTACCTAAGAGTAAGGCTACAGAAGCTACTAAAATAGCCAT
AGATGCTGGTTTCCGCCATATTGATTCTGCTTCTATGTATCAAAATGAAAAGGAAGTAGGACTAGCCATC
CGAAGCAAGATAGCAGATGGCACTGTGAAGAGGGAAGATATATTTTACACATCAAAGGTTTGGTGTACTT
TTCATCGTCCAGAACTCGTACGGGTCTGCTTGGAACAGTCATTGAAGCAACTCCAGTTGGACTATGTGGA
CCTGTACCTCATTCATTTCCCAATGGCCATGAAGCCGGGAGAAAATTATCTCCCAAAAGATGAAAATGGA
AAATTAATATATGATGCTGTGGATATCTGTGACACCTGGGAAGCCATGGAGAAATGCAAGGATGCAGGAT
TGGCCAAGTCCATTGGGGTGTCCAACTTTAACCGCAGGCAGCTGGAGAAGATCCTGAAAAAGCC
Notes:The probe template was PCR amplified from IMAGE:2922019 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2922019 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000002 same experiment
 EMAGE:31482 same embryo
 EMAGE:30794 same embryo
 EMAGE:30359 same embryo
 EMAGE:29358 same embryo
 EMAGE:31247 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS