Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31247

Cyp3a11 ( MGI:88609)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31247 EMAGE:31247 EMAGE:31247 EMAGE:31247 EMAGE:31247
euxassay_000018_01 euxassay_000018_02 euxassay_000018_03 euxassay_000018_04 euxassay_000018_05
EMAGE:31247 EMAGE:31247 EMAGE:31247 EMAGE:31247 EMAGE:31247
euxassay_000018_06 euxassay_000018_07 euxassay_000018_08 euxassay_000018_09 euxassay_000018_10
EMAGE:31247 EMAGE:31247 EMAGE:31247 EMAGE:31247 EMAGE:31247
euxassay_000018_11 euxassay_000018_12 euxassay_000018_13 euxassay_000018_14 euxassay_000018_15
EMAGE:31247 EMAGE:31247 EMAGE:31247 EMAGE:31247 EMAGE:31247
euxassay_000018_16 euxassay_000018_17 euxassay_000018_18 euxassay_000018_19 euxassay_000018_20
EMAGE:31247 EMAGE:31247 EMAGE:31247 EMAGE:31247
euxassay_000018_21 euxassay_000018_22 euxassay_000018_23 euxassay_000018_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
masseter
moderate moderate
regionalmoderate expression: see section 22
pectoral girdle and thoracic body wall skeleton
moderate moderate
regionalmoderate expression: see section 19
axial skeleton thoracic region
strong strong
regionalstrong expression: see section 20 21 22
clavicle
weak weak
regionalweak expression: see section 15 16
rectum
weak weak
regionalweak expression: see section 14
axial skeleton
strong strong
regionalstrong expression: see section 20 21
nose
weak weak
regionalweak expression: see section 07 08 20
tricuspid valve
strong strong
regionalstrong expression: see section 10
skeleton
strong strong
regionalstrong expression: see section 20 21 moderate expression: see section 19
ethmoid bone primordium
strong strong
regionalstrong expression: see section 22
otic capsule
moderate moderate
regionalmoderate expression: see section 22
mitral valve
strong strong
regionalstrong expression: see section 14
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 22
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 23 moderate expression: see section 03 04 22 weak expression: see section 21
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 22
nasal cavity
strong strong
regionalstrong expression: see section 22
nasal septum
weak weak
regionalweak expression: see section 10
mandible
weak weak
regionalweak expression: see section 18 21
middle ear mesenchyme
weak weak
regionalweak expression: see section 01
upper arm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02
inner ear vestibular component
moderate moderate
regionalmoderate expression: see section 22
vault of skull
strong strong
regionalstrong expression: see section 03 23 24 moderate expression: see section 04
cranium
strong strong
regionalstrong expression: see section 23 24
urethral fold of male
moderate moderate
regionalmoderate expression: see section 13
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 14 15
premaxilla
weak weak
regionalweak expression: see section 18
tubotympanic recess
weak weak
regionalweak expression: see section 01
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 12 17
lower jaw skeleton
weak weak
regionalweak expression: see section 18
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 moderate expression: see section 09
vomeronasal organ
weak weak
regionalweak expression: see section 11
gut
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 16
physiological umbilical hernia
moderate moderate
regionalmoderate expression: see section 11
maxilla
weak weak
regionalweak expression: see section 18
nucleus pulposus
moderate moderate
homogeneousmoderate expression: see section 14 weak expression: see section 12
liver
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
lower jaw incisor
weak weak
regionalweak expression: see section 18
upper jaw incisor
weak weak
regionalweak expression: see section 17
lung
moderate moderate
spottedmoderate expression: see section 06 08 09 10 14 15 16 17 18 19 20 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1480
Entity Detected:Cyp3a11, ( MGI:88609)
Sequence:sense strand is shown

>T1480
CCTCNANNCTGTTGGCCTACTGGAGAGTGGGCAGAGGGAAGCATTGAGGAGGATCACACACACAGTTGTA
GGGAGAACACAGAGAAGTAAATTGCTGACAAACAAGCAGGGATGGACCTGGTTTCAGCTCTCTCACTGGA
AACCTGGGTGCTCCTAGCAATCAGCTTGGTGCTCCTCTACCGATATGGGACTCGTAAACATGAACTTTTT
AAGAAACAGGGAATTCCTGGGCCCAAACCTCTGCCATTTTTAGGCACTGTGCTGAATTATTACAAGGGTT
TATGGAAATTCGACATGGAGTGCTATAAAAAGTATGGAAAAACATGGGGGTTGTTTGATGGTCAAACGCC
TCTCCTTGCTGTCACAGACCCAGAGACGATTAAGAATGTGCTAGTGAAGGAATGTTTTTCTGTCTTCACA
AACCGGCGGGATTTTGGCCCAGTGGGGATAATGAGTAAAGCTATCTCAATATCTAAGGATGATGAATGGA
AGAGATATAGAGCTTTGCTGTCCCCCACATTCACCAGTGGAAAACTCAAGGAGATGTTCCCTGTCATTGA
ACAGTATGGAGACATTT
Notes:The probe template was PCR amplified from IMAGE:2921774 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2921774 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000018 same experiment
 EMAGE:31482 same embryo
 EMAGE:31224 same embryo
 EMAGE:30794 same embryo
 EMAGE:30359 same embryo
 EMAGE:29358 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS