Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31251

Unc5d unc-5 homolog D (C. elegans) ( MGI:2389364)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31251 EMAGE:31251 EMAGE:31251 EMAGE:31251 EMAGE:31251
euxassay_012466_01 euxassay_012466_02 euxassay_012466_03 euxassay_012466_04 euxassay_012466_05
EMAGE:31251 EMAGE:31251 EMAGE:31251 EMAGE:31251 EMAGE:31251
euxassay_012466_06 euxassay_012466_07 euxassay_012466_08 euxassay_012466_09 euxassay_012466_10
EMAGE:31251 EMAGE:31251 EMAGE:31251 EMAGE:31251 EMAGE:31251
euxassay_012466_11 euxassay_012466_12 euxassay_012466_13 euxassay_012466_14 euxassay_012466_15
EMAGE:31251 EMAGE:31251 EMAGE:31251 EMAGE:31251 EMAGE:31251
euxassay_012466_16 euxassay_012466_17 euxassay_012466_18 euxassay_012466_19 euxassay_012466_20
EMAGE:31251 EMAGE:31251
euxassay_012466_21 euxassay_012466_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 08 09 12 weak expression: see section 13
metencephalon basal plate
strong strong
regionalstrong expression: see section 05 17 moderate expression: see section 06 07 08 13 14 15 16 weak expression: see section 09 10 11 12
ventral grey horn
weak weak
regionalweak expression: see section 09 10 11 12 13 14
palatal shelf
weak weak
regionalweak expression: see section 09 10 12
clavicle
weak weak
regionalweak expression: see section 08 14
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 12 13 weak expression: see section 07 08 09 10 11 14
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 15 16 moderate expression: see section 06 07 08 09 10 12 13 14 weak expression: see section 11 not examined expression: see section 05 17
lower jaw molar
weak weak
regionalweak expression: see section 06 16
upper jaw molar
weak weak
regionalweak expression: see section 05 06 16 17
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 09 12 weak expression: see section 10
vibrissa
weak weak
regionalweak expression: see section 04
upper lip
strong strong
regionalstrong expression: see section 11
telencephalon mantle layer
strong strong
regionalstrong expression: see section 02 03 07 14 20 moderate expression: see section 08 09 10 12 13
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 11 12 13 14 15 16 17 weak expression: see section 07 08 09 10
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 12 13 14 15 16 weak expression: see section 07 08 09 10 11
lower jaw incisor
weak weak
regionalweak expression: see section 08 14
upper jaw incisor
weak weak
regionalweak expression: see section 08 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38081
Entity Detected:Unc5d, unc-5 homolog D (C. elegans) ( MGI:2389364)
Sequence:sense strand is shown

>T38081
AGTCCACATCCTGTTACTGCCTCTTGGATCCCTTTGCCTGTCACGTGCTGCTTGATAGCTTTGGAACGTA
TGCCCTCACAGGAGAGCCAATCACAGACTGTGCCGTAAAGCAGCTCAAGGTGGCTGTGTTTGGCTGCATG
TCCTGTAACTCCTTGGATTACAACCTGAGAGTTTACTGTGTGGACAATACTCCTTGTGCATTTCAGGAAG
TGATTTCTGACGAACGGCACCAAGGCGGCCAGCTCCTGGAAGAACCAAAGCTGCTGCATTTCAAAGGGAA
TACATTCAGTCTCCAGGTCTCTGTCCTTGACATCCCTCCCTTCCTCTGGAGGATCAAACCGTTCACTGCA
TGCCAGGAAGTCCCCTTCTCCCGAGTGTGGAGCAGCAACCGGCAGCCCCTGCACTGTGCCTTCTCCCTGG
AGCGCTACACGCCCACCACCACCCAGCTGTCCTGCAAAATCTGCATTCGGCAGCTCAAAGGCCATGAACA
GATCCTCCAAGTGCAGACATCCATCCTAGAGAGTGAACGAGAAACCATCACTTTCTTCGCACAAGAGGAC
AGTACCTTTCCTGCACAGACTGGCCCAAAAGCCTTCAAAATTCCCTATTCCATCAGACAGAGGATCTGCG
CCACGTTTGATACCCCAAATGCCAAAGGCAAGGACTGGCAGATGTTAGCACAGAAGAACAGCATCAATAG
GAATTTATCATATTTCGCTACCCAAAGCAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 92949. Forward Primer - name:092949_F_cDNA_Unc5d, sequence:AGTCCACATCCTGTTACTGCCT; Reverse Primer - name:092949_N_SP6_cDNA_Unc5d, sequence:GCTGCTTTGGGTAGCGAAAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012466 same experiment
 EMAGE:31670 same embryo
 EMAGE:31252 same embryo
 EMAGE:29641 same embryo
 EMAGE:31254 same embryo
 EMAGE:30532 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS