Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31311

Fabp7 fatty acid binding protein 7, brain ( MGI:101916)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31311 EMAGE:31311 EMAGE:31311 EMAGE:31311 EMAGE:31311
euxassay_000474_01 euxassay_000474_02 euxassay_000474_03 euxassay_000474_04 euxassay_000474_05
EMAGE:31311 EMAGE:31311 EMAGE:31311 EMAGE:31311 EMAGE:31311
euxassay_000474_06 euxassay_000474_07 euxassay_000474_08 euxassay_000474_09 euxassay_000474_10
EMAGE:31311 EMAGE:31311 EMAGE:31311 EMAGE:31311 EMAGE:31311
euxassay_000474_11 euxassay_000474_12 euxassay_000474_13 euxassay_000474_14 euxassay_000474_15
EMAGE:31311 EMAGE:31311 EMAGE:31311 EMAGE:31311 EMAGE:31311
euxassay_000474_16 euxassay_000474_17 euxassay_000474_18 euxassay_000474_19 euxassay_000474_20
EMAGE:31311 EMAGE:31311
euxassay_000474_21 euxassay_000474_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 02 12 13 17
ventral grey horn
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 15 16
olfactory cortex marginal layer
moderate moderate
homogeneousmoderate expression: see section 02 13 14 16 17
medulla oblongata basal plate ventricular layer
moderate moderate
homogeneousmoderate expression: see section 02 12 13 14 15 16 17 18
pons ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 11 12 13 14 15 16 17 18 19 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 01 11 19 20 weak expression: see section 10
rest of cerebellum ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 07 08 09 10 11 12 13 19 20 21 22
pons mantle layer
moderate moderate
spottedmoderate expression: see section 02 11 12 13 14 15 16 17 18 19 20 21
hypothalamus mantle layer
moderate moderate
spottedmoderate expression: see section 01 02 12 17 18 19
dorsal root ganglion
strong strong
regionalstrong expression: see section 01 12 13 14 15 moderate expression: see section 17 18 19 20 21
medulla oblongata basal plate mantle layer
moderate moderate
spottedmoderate expression: see section 02 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 08 11 20 22 weak expression: see section 21
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 01 08 18 19 20 22 weak expression: see section 03 07 09 10 11 21
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
cerebellum intraventricular portion ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 11 12 13 19
midbrain ventricular layer
moderate moderate
homogeneousmoderate expression: see section 02 12 13 14 15 16 17 18 19 20
nasal cavity olfactory epithelium
moderate moderate
homogeneousmoderate expression: see section 02
hypothalamus ventricular layer
moderate moderate
homogeneousmoderate expression: see section 02 12 13 14 15 16
rest of cerebellum
moderate moderate
homogeneousmoderate expression: see section 20
telencephalon mantle layer
moderate moderate
spottedmoderate expression: see section 01 03 04 05 06 07 08 09 10 11 20 21 22
midbrain mantle layer
moderate moderate
spottedmoderate expression: see section 01 02 12 13 14 17 18 19 20
diencephalon lateral wall mantle layer
moderate moderate
spottedmoderate expression: see section 12 13 14 17 18 19 20
diencephalon lateral wall ventricular layer
moderate moderate
homogeneousmoderate expression: see section 02 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T535
Entity Detected:Fabp7, fatty acid binding protein 7, brain ( MGI:101916)
Sequence:sense strand is shown

>T535
TCCTCGAGNCTGTTGGCCTACTGGGTGCAAAGGGTTTTTGTGAATTACGGTGGTGGGTAAGACCCGAGTT
CCTCCAGTTCCTGCCTATTTTCAGCTGACTAGGCGGTTAAGGATGGTAGATGCTTTCTGCGCAACCTGGA
AGCTGACAGACAGTCAGAATTTTGATGAGTACATGAAAGCTCTGGGCGTGGGCTTTGCCACTAGGCAAGT
GGGAAACGTGACCAAACCAACTGTGATTATCAGTCAGGAAGGTGGCAAAGTGGTGATCCGGACACAATGC
ACATTCAAGAACACAGAGATCAATTTCCAGCTGGGAGAAGAGTTTGAAGAAACCAGCATAGATGACAGAA
ACTGTAAGTCTGTGGTTCGGTTGGATGGAGACAAGCTCATTCATGTGCAGAAGTGGGATGGCAAAGAAAC
AAATTGTACCAGAGAAATTAAGGATGGCAAGATGGTCGTGACTCTTACCTTTGGGGATATCGTTGCTGTT
CGCTGTTATGAAAAGGCATAGAGGAGATGACAGGACTTTTGACAACTTGGTTT
Notes:The probe template was PCR amplified from IMAGE:1498784 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1498784 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000474 same experiment
 EMAGE:30283 same embryo
 EMAGE:30277 same embryo
 EMAGE:30297 same embryo
 EMAGE:30253 same embryo
 EMAGE:30268 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS