Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31420

Mtus2 microtubule associated tumor suppressor candidate 2 ( MGI:1915388)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31420 EMAGE:31420 EMAGE:31420 EMAGE:31420 EMAGE:31420
euxassay_000087_01 euxassay_000087_02 euxassay_000087_03 euxassay_000087_04 euxassay_000087_05
EMAGE:31420 EMAGE:31420 EMAGE:31420 EMAGE:31420 EMAGE:31420
euxassay_000087_06 euxassay_000087_07 euxassay_000087_08 euxassay_000087_09 euxassay_000087_10
EMAGE:31420 EMAGE:31420 EMAGE:31420 EMAGE:31420 EMAGE:31420
euxassay_000087_11 euxassay_000087_12 euxassay_000087_13 euxassay_000087_14 euxassay_000087_15
EMAGE:31420 EMAGE:31420 EMAGE:31420 EMAGE:31420 EMAGE:31420
euxassay_000087_16 euxassay_000087_17 euxassay_000087_18 euxassay_000087_19 euxassay_000087_20
EMAGE:31420 EMAGE:31420 EMAGE:31420 EMAGE:31420
euxassay_000087_21 euxassay_000087_22 euxassay_000087_23 euxassay_000087_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
heart ventricle
strong strong
regionalstrong expression: see section 08 14 15 16 17 moderate expression: see section 07 09 11 12 13
pituitary gland
weak weak
regionalweak expression: see section 13
vestibulocochlear viii ganglion
strong strong
homogeneousstrong expression: see section 08 09 19 20
hypogastric plexus
strong strong
regionalstrong expression: see section 10 moderate expression: see section 11 12 weak expression: see section 03 05 08 13 14 15
spinal cord
moderate moderate
homogeneousmoderate expression: see section 13 18
epithalamus
strong strong
regionalstrong expression: see section 16
interventricular septum
strong strong
regionalstrong expression: see section 14
telencephalon
moderate moderate
homogeneousmoderate expression: see section 20 weak expression: see section 09
vagus x ganglion
strong strong
homogeneousstrong expression: see section 09 19 20
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22 23
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 03
hindbrain
strong strong
regionalstrong expression: see section 07 10 12 13 14 15 16 21 moderate expression: see section 11 19 20 weak expression: see section 09 23
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 09 20
pons mantle layer
strong strong
regionalstrong expression: see section 16
retina
strong strong
regionalstrong expression: see section 01 22 23 24
pons
strong strong
regionalstrong expression: see section 13 16 moderate expression: see section 17 18
medulla oblongata basal plate marginal layer
strong strong
regionalstrong expression: see section 14 15
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 10 11 12 16 17 18 19
adenohypophysis
moderate moderate
single cellmoderate expression: see section 14 weak expression: see section 12
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 13 14 15
medulla oblongata basal plate
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 17 18
heart
strong strong
single cellstrong expression: see section 15 17
nucleus pulposus
moderate moderate
regionalmoderate expression: see section 13
diencephalon lateral wall
strong strong
regionalstrong expression: see section 16 moderate expression: see section 15
diencephalon lamina terminalis
strong strong
regionalstrong expression: see section 16
diencephalon roof plate
moderate moderate
regionalmoderate expression: see section 15
vagal x nerve trunk
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 13
metencephalon alar plate
strong strong
regionalstrong expression: see section 16
metencephalon lateral wall
strong strong
regionalstrong expression: see section 07
metencephalon
strong strong
regionalstrong expression: see section 13
metencephalon basal plate
strong strong
regionalstrong expression: see section 16
interventricular septum muscular part
strong strong
regionalstrong expression: see section 14
medulla oblongata alar plate
moderate moderate
regionalmoderate expression: see section 17
cerebral cortex marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 06 19 20 weak expression: see section 08 23
midbrain
strong strong
regionalstrong expression: see section 07 moderate expression: see section 10 11 18 19 20 weak expression: see section 09
diencephalon
strong strong
regionalstrong expression: see section 16 moderate expression: see section 11 14 15 17 18 weak expression: see section 09
midbrain mantle layer
strong strong
regionalstrong expression: see section 07
neural retina
strong strong
regionalstrong expression: see section 02
spinal cord mantle layer
strong strong
regionalstrong expression: see section 14 moderate expression: see section 17
thalamus
strong strong
regionalstrong expression: see section 16 moderate expression: see section 14 15
right ventricle cardiac muscle
strong strong
regionalstrong expression: see section 08 moderate expression: see section 09 10
heart right ventricle
strong strong
single cellstrong expression: see section 08 moderate expression: see section 10
alar columns
moderate moderate
regionalmoderate expression: see section 17
forebrain
strong strong
regionalstrong expression: see section 16 moderate expression: see section 11
cerebral cortex
moderate moderate
regionalmoderate expression: see section 19 20 weak expression: see section 05 09 12
left ventricle cardiac muscle
strong strong
regionalstrong expression: see section 14
hypothalamus
moderate moderate
regionalmoderate expression: see section 14 15
olfactory lobe
strong strong
regionalstrong expression: see section 15 16 moderate expression: see section 11 weak expression: see section 08 09 13
spinal cord lateral wall
strong strong
regionalstrong expression: see section 14 moderate expression: see section 18
heart left ventricle
strong strong
regionalstrong expression: see section 14 15 16
lung
strong strong
single cellstrong expression: see section 04 08 20 21 moderate expression: see section 05 06 10 weak expression: see section 12 15 16 17 19 22 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1588
Entity Detected:Mtus2, microtubule associated tumor suppressor candidate 2 ( MGI:1915388)
Sequence:sense strand is shown

>T1588
TATNCCGCGAAGACACATTGCGCTGGCTCCATACCAGCACCTGGAAGAAGACATGCAGANCCTGNAGCAG
GTGCTGGAGATGAAGAACCAGCAGATCCACCTGCAGGAGAAGAAGATCATCGAGCTGGAAAAGCTGGTGG
AAAAGAATATCATCCTGGAAGAAAGGATCCAGGTGCTGCAGCAGCAGAATGAAGACCTCAAAGCGAGGAT
CGACCAGAACACAGTTGTCACCAGACAACTGTCGGAGGAAAATGCAAACCTCCAGGAATACGTGGAGAAA
GAGACCCAGGAAAAGAAGAGACTGAGCCGAACCAACGAAGAACTACTTTGGAAGCTCCAAACGGGGGACC
CAACCAGCCCGATTAAACTCTCCCCTACATCTCCAGTGTACAGAGGCTCCTCCTCTGGACCCTCCTCTCC
GGCCAGAGTCAGTACCACACCTAGATGACATCACCCTGCCACCCATAGGAGCTCAGGCTTCTGCCCATCT
GAGGGCGTGCTGG
Notes:The probe template was PCR amplified from IMAGE:977543 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:977543 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000087 same experiment
 EMAGE:31419 same embryo
 EMAGE:31936 same embryo
 EMAGE:30637 same embryo
 EMAGE:30635 same embryo
 EMAGE:30780 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS