Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31466

S100a1 ( MGI:1338917)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31466 EMAGE:31466 EMAGE:31466 EMAGE:31466 EMAGE:31466
euxassay_003348_01 euxassay_003348_02 euxassay_003348_03 euxassay_003348_04 euxassay_003348_05
EMAGE:31466 EMAGE:31466 EMAGE:31466 EMAGE:31466 EMAGE:31466
euxassay_003348_06 euxassay_003348_07 euxassay_003348_08 euxassay_003348_09 euxassay_003348_10
EMAGE:31466 EMAGE:31466 EMAGE:31466 EMAGE:31466 EMAGE:31466
euxassay_003348_11 euxassay_003348_12 euxassay_003348_13 euxassay_003348_14 euxassay_003348_15
EMAGE:31466 EMAGE:31466 EMAGE:31466 EMAGE:31466 EMAGE:31466
euxassay_003348_16 euxassay_003348_17 euxassay_003348_18 euxassay_003348_19 euxassay_003348_20
EMAGE:31466 EMAGE:31466 EMAGE:31466 EMAGE:31466
euxassay_003348_21 euxassay_003348_22 euxassay_003348_23 euxassay_003348_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
heart ventricle
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 weak expression: see section 14 15 16 17 18
cochlear duct
strong strong
regionalstrong expression: see section 03 04 05 06 07 18 19 20 21 22 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1766
Entity Detected:S100a1, ( MGI:1338917)
Sequence:sense strand is shown

>T1766
TGGCCTCGAGCCAGATTCGGCACGAGGTGCCCTTCTGTCGAGAATCTGTTCCGACGTCAGGCCGAGGCCA
ACCGTGTGCTGCTGAAATGGGCTCTGAGCTGGAGAGTGCCATGGAGACCCTCATCAATGTGTTCCATGCC
CATTCGGGCAAGGAAGGGGACAAATATAAGCTGAGCAAGAAAGAACTGAAAGACCTGCTACAAACTGAAC
TTTCTGGCTTCCTGGATGTCCAGAAGGATGCAGATGC
Notes:The probe template was PCR amplified from IMAGE:484210 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:484210 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_003348 same experiment
 EMAGE:31150 same embryo
 EMAGE:31198 same embryo
 EMAGE:31152 same embryo
 EMAGE:29396 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS