Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31473

Usf1 upstream transcription factor 1 ( MGI:99542)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31473 EMAGE:31473 EMAGE:31473 EMAGE:31473 EMAGE:31473
euxassay_012287_01 euxassay_012287_02 euxassay_012287_03 euxassay_012287_04 euxassay_012287_05
EMAGE:31473 EMAGE:31473 EMAGE:31473 EMAGE:31473 EMAGE:31473
euxassay_012287_06 euxassay_012287_07 euxassay_012287_08 euxassay_012287_09 euxassay_012287_10
EMAGE:31473 EMAGE:31473 EMAGE:31473 EMAGE:31473 EMAGE:31473
euxassay_012287_11 euxassay_012287_12 euxassay_012287_13 euxassay_012287_14 euxassay_012287_15
EMAGE:31473 EMAGE:31473 EMAGE:31473 EMAGE:31473 EMAGE:31473
euxassay_012287_16 euxassay_012287_17 euxassay_012287_18 euxassay_012287_19 euxassay_012287_20
EMAGE:31473 EMAGE:31473 EMAGE:31473
euxassay_012287_21 euxassay_012287_22 euxassay_012287_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 20 21 weak expression: see section 01 22
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 07 08
forebrain
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
spinal cord
weak weak
homogeneousweak expression: see section 11 12 13 14 15 16 17
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 07 08
trigeminal v nerve
weak weak
regionalweak expression: see section 07 15
testis
moderate moderate
regionalmoderate expression: see section 07 18 19 weak expression: see section 06 08 17 20
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 10 11 15 16 17 18 19
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 19 20
lower jaw molar
weak weak
regionalweak expression: see section 04 05 17
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 17 weak expression: see section 08 09 16
midbrain
weak weak
homogeneousweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
upper jaw molar
weak weak
regionalweak expression: see section 04 05 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 05 06 17 18 19 20 21 weak expression: see section 04 07 15 16
renal cortex
weak weak
regionalweak expression: see section 07 08 09 10 15 16 17 18 19
lower jaw incisor
weak weak
regionalweak expression: see section 09 12 13
hindbrain
weak weak
homogeneousweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
upper jaw incisor
weak weak
regionalweak expression: see section 08 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30439
Entity Detected:Usf1, upstream transcription factor 1 ( MGI:99542)
Sequence:sense strand is shown

>T30439
TTCAGGCCTTTGAGTCGGGAGATACAAAGTCCTCCGAAAAAAGACCGGTGCCTCGGATGAGCCCCCTCAC
AGAGAGATGAAGGGGCAGCAGAAAACAGCTGAAACCGAAGAGGGAACAGTGCAGATTCAGGAAGGCGCAG
TGGCTACTGGAGAGGACCCAACTAGTGTAGCTATCGCCAGCATCCAGTCAGCTGCCACTTTTCCTGACCC
CAACGTCAAGTACGTCTTCCGAACTGAGAATGGGGGCCAGGTGATGTACAGGGTGATCCAGGTGTCAGAG
GGGCAGCTGGATGGCCAGACAGAGGGCTCTGGCGCCATCAGTGGTTACCCTGCCACTCAGTCTATGACCC
AGGCAGTGATCCAGGGAGCTTTCACCAGTGACGATGCCGTTGACACGGAGGGAGCAGCTGCTGAGACACA
TTATACATATTTCCCCAGCACCGCAGTGGGAGATGGGTCAGGGGGCACCACATCTGGGAGTACAACAGCT
GTTGTTACCACCCAGGGCTCAGAGGCACTACTGGGGCAGGCAACCCCGCCCAGCACAGGTCAATTCTTTG
TGATGATGTCACCACAAGAAGTATTGCAGGGAGGGTGCCAGCGATCGATTGCCCCCAGGACCCACCCTTA
TTCCCCGAAGTCAGAGGCTCCCAGGACAACACGAGATGAGAAACGGAGGGCTCAACATAACGAAGTGGAG
CGCCGCCGCCGGGACAAGATCAACAACTGGATTGTACAGCTGTCCAAAATCATCCCAGACTGCTCTATGG
AGAGCACCAAGTCTGGCCAGAGTAAAGGTGGAATCCTGTCCAAAGCCTGTGATTATATCCAGGAGCTGCG
GCAGAGCAACCACCGGCTGTCTGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6506829), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58569. Forward Primer - name:058569_F_IRAV105_e08_Usf1, sequence:TTCAGGCCTTTGAGTCGG; Reverse Primer - name:058569_R_SP6_IRAV105_e08_Usf1, sequence:TTCAGACAGCCGGTGGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012287 same experiment
 EMAGE:31191 same embryo
 EMAGE:31169 same embryo
 EMAGE:32005 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS