Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31479

Pde3a phosphodiesterase 3A, cGMP inhibited ( MGI:1860764)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31479 EMAGE:31479 EMAGE:31479 EMAGE:31479 EMAGE:31479
euxassay_007701_01 euxassay_007701_02 euxassay_007701_03 euxassay_007701_04 euxassay_007701_05
EMAGE:31479 EMAGE:31479 EMAGE:31479 EMAGE:31479 EMAGE:31479
euxassay_007701_06 euxassay_007701_07 euxassay_007701_08 euxassay_007701_09 euxassay_007701_10
EMAGE:31479 EMAGE:31479 EMAGE:31479 EMAGE:31479 EMAGE:31479
euxassay_007701_11 euxassay_007701_12 euxassay_007701_13 euxassay_007701_14 euxassay_007701_15
EMAGE:31479 EMAGE:31479 EMAGE:31479 EMAGE:31479 EMAGE:31479
euxassay_007701_16 euxassay_007701_17 euxassay_007701_18 euxassay_007701_19 euxassay_007701_20
EMAGE:31479 EMAGE:31479
euxassay_007701_21 euxassay_007701_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 13
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09
cranium
moderate moderate
regionalmoderate expression: see section 01 02 03 04
rectum
moderate moderate
regionalmoderate expression: see section 11
urethra of male
moderate moderate
regionalmoderate expression: see section 11
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 17
nose
moderate moderate
regionalmoderate expression: see section 05 06 07 08 10 11 12 13 14 15 16 17
midgut
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 moderate expression: see section 09
bladder
moderate moderate
regionalmoderate expression: see section 10 11 12 13
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 15 16 17
basioccipital bone
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
aorta
strong strong
regionalstrong expression: see section 08 09 10 11 12
renal medullary interstitium
strong strong
spottedstrong expression: see section 06 07 08 09 14 15 16 17
vibrissa
strong strong
regionalstrong expression: see section 01 02 03 04 05 15 16 17 18 19
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 06 19 moderate expression: see section 05 20
upper lip
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
naris
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12
liver
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 12 13 14 15 16 17 18
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
lower lip
strong strong
regionalstrong expression: see section 03 04 05 06 13 14 15 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36763
Entity Detected:Pde3a, phosphodiesterase 3A, cGMP inhibited ( MGI:1860764)
Sequence:sense strand is shown

>T36763
ATGATGTCGGGATAGATTGGACCAATGAAAACGACCGTCTCCTGGTGTGTCAGATGTGTATAAAGCTGGC
TGACATCAACGGGCCTGCTAAATGCAAAGAACTCCACCTGCGGTGGACAGAGGGCATCGCCAGCGAGTTT
TATGAGCAGGGCGATGAAGAAGCCAGCCTCGGCTTGCCCATAAGTCCCTTTATGGACCGCTCTGCCCCGC
AGCTGGCCAATCTTCAGGAATCCTTTATCTCACACATCGTGGGTCCTCTCTGCCACTCCTATGACTCTGC
GGGACTCATGCCAGGAAAATGGGTAGATGACAGTGATGATTCCGGAGACACCGATGACCCGGAAGAAGAG
GAGGAAGAGGCTGAAACACCACACGAGGACGAAGCCTGTGAAAGCAGTATAGCTCCCCGAAAGAAAAGTT
TCAAAAGAAGGAGAATCTACTGCCAAATAACTCAGCACCTTCTGCAGAACCACATGATGTGGAAGAAAGT
GATTGAAGAGGAACAGTGTTTATCAGGCACAGAGAACCAGTCCCTGGACCAGGTCCCTCTGCAGCATCCC
TCAGAGCAGATCCAGGCTATCAAGGAGGAAGAGGAAGAGAAGGGGAAGCCAAGAGCAGAGGAGACCCTGG
CTCCACAGCCAGACCTGTGACCATGGGTAGAGCGAGCTGTGTTTGCAGACAGAATGACTCGTCTCAGACA
TT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100309. Forward Primer - name:100309_F_cDNA_Pde3a, sequence:ATGATGTCGGGATAGATTGGAC; Reverse Primer - name:100309_N_SP6_cDNA_Pde3a, sequence:AATGTCTGAGACGAGTCATTCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007701 same experiment
 EMAGE:29553 same embryo
 EMAGE:31552 same embryo
 EMAGE:29559 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS