Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31518

1110020P15Rik ( MGI:1913402)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31518 EMAGE:31518 EMAGE:31518 EMAGE:31518 EMAGE:31518
euxassay_001948_01 euxassay_001948_02 euxassay_001948_03 euxassay_001948_04 euxassay_001948_05
EMAGE:31518 EMAGE:31518 EMAGE:31518 EMAGE:31518 EMAGE:31518
euxassay_001948_06 euxassay_001948_07 euxassay_001948_08 euxassay_001948_09 euxassay_001948_10
EMAGE:31518 EMAGE:31518 EMAGE:31518 EMAGE:31518 EMAGE:31518
euxassay_001948_11 euxassay_001948_12 euxassay_001948_13 euxassay_001948_14 euxassay_001948_15
EMAGE:31518 EMAGE:31518 EMAGE:31518 EMAGE:31518 EMAGE:31518
euxassay_001948_16 euxassay_001948_17 euxassay_001948_18 euxassay_001948_19 euxassay_001948_20
EMAGE:31518 EMAGE:31518 EMAGE:31518 EMAGE:31518
euxassay_001948_21 euxassay_001948_22 euxassay_001948_23 euxassay_001948_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
foregut-midgut junction
weak weak
regionalweak expression: see section 11 12 13 14 15
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 08 10 11 12 13
frontal bone primordium
moderate moderate
regionalmoderate expression: see section 24 weak expression: see section 01 02 03 04
midgut
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17 18 19
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 06 07 08 12 13
pancreas
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 17 20 21 22 23 weak expression: see section 18 19
submandibular gland primordium
strong strong
regionalstrong expression: see section 15 16 17 18
upper jaw molar
moderate moderate
regionalmoderate expression: see section 09
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
thymus primordium
strong strong
homogeneousstrong expression: see section 10 11 12 13 14
renal cortex
weak weak
homogeneousweak expression: see section 05 06 07 08 13 14 15 16
adrenal gland
moderate moderate
homogeneousmoderate expression: see section 05 06 07 13 14
vibrissa
weak weak
regionalweak expression: see section 06 07 08 20 21
hindgut
weak weak
regionalweak expression: see section 11 12
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 weak expression: see section 12 16 17 18 19 20 21 22
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15 16
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 05 06 20 21 22 23 24 weak expression: see section 03 04
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T4574
Entity Detected:1110020P15Rik, ( MGI:1913402)
Sequence:sense strand is shown

>T4574
GCGAGTTCGGCAGTGAGGCAACATGTCGTCGCCGACGATCCCTTCGCGCCTGTACTCCTTGCTGTTCCGC
AGAACTTCCACCTTTGCCCTCACCATCGCAGTGGGCGCCCTGTTCTTTGAGCGAGCCTTCGATCAGGGCG
CAGACGCGATCTACGAGCACATCAACGAGGGGAAACTGTGGAAACATATAAAGCACAAGTATGAGAACAA
GGAGTAACACCCTGCCCCTGTGGGACCCGAAGGAACAGTCGCCGGTCAGCTGTTTGCCTGGAATTGGGGC
CTCAGCCTAAGGATGAGTTTCAAGTTGCCGTTCACCGACCGCCAGTGTGTGGGCAAGCTATGGCTCCACT
GTACAAACAGACTCACTTCTGCTGTGTTTGAGTACAGCTGTCAGCAAATAAATGCAAAGTGCTCATGAGA
AAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:4984172 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:4984172 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001948 same experiment
 EMAGE:32192 same embryo
 EMAGE:31460 same embryo
 EMAGE:31827 same embryo
 EMAGE:31721 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS