Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31548

Dstn ( MGI:1929270)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31548 EMAGE:31548 EMAGE:31548 EMAGE:31548 EMAGE:31548
euxassay_001919_01 euxassay_001919_02 euxassay_001919_03 euxassay_001919_04 euxassay_001919_05
EMAGE:31548 EMAGE:31548 EMAGE:31548 EMAGE:31548 EMAGE:31548
euxassay_001919_06 euxassay_001919_07 euxassay_001919_08 euxassay_001919_09 euxassay_001919_10
EMAGE:31548 EMAGE:31548 EMAGE:31548 EMAGE:31548 EMAGE:31548
euxassay_001919_11 euxassay_001919_12 euxassay_001919_13 euxassay_001919_14 euxassay_001919_15
EMAGE:31548 EMAGE:31548 EMAGE:31548 EMAGE:31548 EMAGE:31548
euxassay_001919_16 euxassay_001919_17 euxassay_001919_18 euxassay_001919_19 euxassay_001919_20
EMAGE:31548 EMAGE:31548
euxassay_001919_21 euxassay_001919_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
oral epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 17 18 19
heart ventricle
strong strong
regionalstrong expression: see section 06 07 08 09 10 moderate expression: see section 11 12 13 14 15 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 07 13
spinal cord
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 11 12 13
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 09
bladder
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11
esophagus
moderate moderate
regionalmoderate expression: see section 08 09 10 11
cornea stroma
strong strong
regionalstrong expression: see section 01 02 03 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 07 15
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 20 21 22
trachea
weak weak
regionalweak expression: see section 11
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 09 10 14 15 16 17 18 19 20 21 22
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 09 weak expression: see section 10
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 15 16 17 18 19 20
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 13
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 17 18 19 not examined expression: see section 20
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 14 15 16 17
hindgut
strong strong
regionalstrong expression: see section 08 09 10 11 12 13
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
neural retina
strong strong
regionalstrong expression: see section 01 02 03 20 21 22
cornea epithelium
strong strong
regionalstrong expression: see section 01 02 03 20 21 22
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10
brain
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 16
midgut
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16
thyroid gland
moderate moderate
homogeneousmoderate expression: see section 09 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 05 06 07 10 11 12 13 14 15
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 08 15 16 17
heart atrium
strong strong
regionalstrong expression: see section 06 07 08 09 moderate expression: see section 12 13 14 15 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T668
Entity Detected:Dstn, ( MGI:1929270)
Sequence:sense strand is shown

>T668
GTTGGCCNACTGGCATTTTCTACGACATGAAAGTTCGGAAATGTTCCACACCAGAAGAAATCAAGAAAAG
AAAGAAGGCTGTCATTTTCTGTCTCAGTGCAGACAAAAAGTGCATAGTCGTTGAAGAAGGCAAAGAGATC
TTGGTGGGAGATGTTGGCGCCACCATAACTGATCCTTTCAAGCATTTTGTCGGAATGCTTCCTGAAAAAG
ATTGTCGCTATGCTTTGTATGACGCCAGCTTTGAGACCAAGGAGTCCAGGAAAGAAGAGCTGATGTTCTT
CCTGTGGGCACCAGAACAAGCACCTCTGAAAAGTAAAATGATCTATGCAAGCTCGAAGGATGCCATCAAG
AAGAAATTTCCAGGTATAAAGCATGAGTATCAAGCAAATGGGCCAGAAGACCTCAATCGGACCTGTATTG
CTGAAAAGCTAGGTGGCTCCTTAATTGTAGCCTTTGAAGGATCCCCTGTGTAGACCGCCAGTCAGTGCCA
CGAGTTGAAAGCTTCCATACTGAACACTATCCTTTC
Notes:The probe template was PCR amplified from IMAGE:1888262 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1888262 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001919 same experiment
 EMAGE:31492 same embryo
 EMAGE:31488 same embryo
 EMAGE:30397 same embryo
 EMAGE:31511 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS