Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31554

Acadl acyl-Coenzyme A dehydrogenase, long-chain ( MGI:87866)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31554 EMAGE:31554 EMAGE:31554 EMAGE:31554 EMAGE:31554
euxassay_005037_01 euxassay_005037_02 euxassay_005037_03 euxassay_005037_04 euxassay_005037_05
EMAGE:31554 EMAGE:31554 EMAGE:31554 EMAGE:31554 EMAGE:31554
euxassay_005037_06 euxassay_005037_07 euxassay_005037_08 euxassay_005037_09 euxassay_005037_10
EMAGE:31554 EMAGE:31554 EMAGE:31554 EMAGE:31554 EMAGE:31554
euxassay_005037_11 euxassay_005037_12 euxassay_005037_13 euxassay_005037_14 euxassay_005037_15
EMAGE:31554 EMAGE:31554 EMAGE:31554 EMAGE:31554 EMAGE:31554
euxassay_005037_16 euxassay_005037_17 euxassay_005037_18 euxassay_005037_19 euxassay_005037_20
EMAGE:31554 EMAGE:31554 EMAGE:31554 EMAGE:31554 EMAGE:31554
euxassay_005037_21 euxassay_005037_22 euxassay_005037_23 euxassay_005037_24 euxassay_005037_25

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
heart ventricle
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 21
metencephalon rest of alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 weak expression: see section 22 23
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 09 18 19
rectum
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 11
left lung
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 weak expression: see section 03 04
axial musculature
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 19 20 21 22
bladder
strong strong
regionalstrong expression: see section 11 12 13 14
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 20
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 weak expression: see section 23 24 25
thymus primordium
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 13 14 15 16 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23 24
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 12 13 15 16 17
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 weak expression: see section 22 23 24
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 12 15 16 17 18 19 20 weak expression: see section 09 10 11
hindgut
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 weak expression: see section 11
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 15 16 17
ventral grey horn
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18
right lung
moderate moderate
regionalmoderate expression: see section 12 13 14 weak expression: see section 15 16 17 18 19 20 21 22 23 24 25
head mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 weak expression: see section 23 24 25
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
stomach
weak weak
regionalweak expression: see section 06 07 08 09 10
kidney calyx
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 16 17 18 19 20
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
urethra of male
weak weak
regionalweak expression: see section 10 11 12
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 21
tongue muscle
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 weak expression: see section 11 18
midgut
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20 weak expression: see section 10 11
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 11 17 18 weak expression: see section 10
aorta
moderate moderate
regionalmoderate expression: see section 11 12 13 14
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T7477
Entity Detected:Acadl, acyl-Coenzyme A dehydrogenase, long-chain ( MGI:87866)
Sequence:sense strand is shown

>T7477
CCGCCGTCCATCCCGCCATGGCTGCGCGCCTGCTCCTCCGCTCCCTGCGCGTCCTGAAAGCCCGCTCGGC
GCCACGCCCGCCGCCCTCCGCCCGATGTTCTCATTCTGGAGCAGAAGCGCGTCTAGAAACTCCTTCTGCT
AAAAAATTAACTGACGTTGGAATCAGGAGAATCTTTTCCTCGGAGCATGACATTTTCCGGGAGAGTGTAA
GGAAGTTTTTCCAAGAAGAAGTGATTCCTCACCACACAGAATGGGAGAAAGCTGGAGAAGTGAGTAGAGA
GGTCTGGGAAAAAGCTGGCAAGCAGGGCTTGCTTGGCATCAACATCGCAGAGAAACATGGCGGCATTGGT
GGGGACTTGCTCTCAACAGCAGTTACTTGGGAAGAGCAAGCGTACTCCAATTGCACAGGCCCTGGCTTCA
GCCTCCACTCAGATATTGTCATGCCCTATATTGCGAATTACGGCACAAAAGAACAGATCGAGAAGTTCAT
CCCCCAGATGACGGCAGGCAAGTGTATCGGTGCCATAGCCATGACAGAGCCTGGGGCCGGAAGTGACTTA
CAAGGAGTAAGAACGAACGCCAAAAGATCTGGGAGTGATTGGATTCTCAATGGAAGCAAGGTGTTCATCA
CTAATGGCTGGTTAAGTGATCTCGTGATCGTCGTGGCCGTCACCAACCGTGAAGCTCGATCGCCTGCCCA
TGGCATTAGCCTCTTTTTGGTGGAAAATGGAATGAAAGGATTTATCAAGGGCCGGAAGCTGCATAAGATG
GGAATGAAAGCTCAGGACACAGCAGAACTATTCTTTGAAGATGTCCGATTGCCAGCTAATGCCTTACTTG
GAGAAGAGAATAAAGGCTTCTACTACCTCATGCAAGAGCTCCCACAGGAAAGGCTCTTAATTGCTGAGTT
GGCGATTTCTGCCTGTGAGTTCATGTTTGAAGAAACCAGGAACTACGTGAAGCAAAGAAAAGCTTTTGGG
AAAACAGTTGCACACATACAGACGGTGCAGCATAAACTAGCAGAATTAAAGACACACATATGTGTCACCA
GAGCTTTTGTGGACAGCTGCCTGCAGTTGCATGAAACCAAACGTCTGGACTCCGGTTCCGCTTCCATGGC
AAAATACTGGGCATCTGAATTACAAAACAGTGTAGCTTATGAATGTGTTCAACTCCACGGAGGCTGGGGG
TACATGTGGGAGTACCCGATTGCAAAAGCTTATGTGGATGCTCGGGTGCAGCCGATCTACGGTGGTACCA
ACGAAATAATGAAAGAGCTGATCGCAAGACAGATCGTCAGTGACAGCTAGACATCTGCCTACATCCTGGA
ATCCTATTACATGCAGCTAATGCGGATTCTAATCTACTTGAGATAAAGTGTAACCTGGAAAAGGGGGGGA
AATGGTAAAGCTGGTTTTATGTATGATTGTTACAGAGAAAGAAATAAAATAGAATTCTAAAGATTAAAAA
AAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:4236225 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:4236225 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_005037 same experiment
 EMAGE:30830 same embryo
 EMAGE:30158 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS