Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31580

Spon1 spondin 1, (f-spondin) extracellular matrix protein ( MGI:2385287)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31580 EMAGE:31580 EMAGE:31580 EMAGE:31580 EMAGE:31580
euxassay_009887_01 euxassay_009887_02 euxassay_009887_03 euxassay_009887_04 euxassay_009887_05
EMAGE:31580 EMAGE:31580 EMAGE:31580 EMAGE:31580 EMAGE:31580
euxassay_009887_06 euxassay_009887_07 euxassay_009887_08 euxassay_009887_09 euxassay_009887_10
EMAGE:31580 EMAGE:31580 EMAGE:31580 EMAGE:31580 EMAGE:31580
euxassay_009887_11 euxassay_009887_12 euxassay_009887_13 euxassay_009887_14 euxassay_009887_15
EMAGE:31580 EMAGE:31580 EMAGE:31580 EMAGE:31580 EMAGE:31580
euxassay_009887_16 euxassay_009887_17 euxassay_009887_18 euxassay_009887_19 euxassay_009887_20
EMAGE:31580 EMAGE:31580 EMAGE:31580
euxassay_009887_21 euxassay_009887_22 euxassay_009887_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
mandible
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 03 04 08 11 15 16 17 20 21 22 weak expression: see section 05 06 18 19
ventral grey horn
strong strong
single cellstrong expression: see section 10 11 12 13 14 15 16 moderate expression: see section 17
medulla oblongata basal plate ventricular layer
strong strong
single cellstrong expression: see section 11 12 13 14 moderate expression: see section 16
pons ventricular layer
strong strong
single cellstrong expression: see section 09 10 11 12 13 14 moderate expression: see section 15 16
pons marginal layer
strong strong
single cellstrong expression: see section 06
pons mantle layer
strong strong
single cellstrong expression: see section 07 08 09 10 11 12 13 14 19 moderate expression: see section 15 16 17 18
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 12 13 14 moderate expression: see section 15 17
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 moderate expression: see section 23
aorta
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
midbrain ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 moderate expression: see section 10 15 weak expression: see section 09
maxilla
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 08 16 17 20 weak expression: see section 06 18
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 12 13
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30933
Entity Detected:Spon1, spondin 1, (f-spondin) extracellular matrix protein ( MGI:2385287)
Sequence:sense strand is shown

>T30933
CCCGGAAGGGAGAACAGTGCAACATTGTACCTGACAACGTGGACGATATTGTAGCCGACCTGGCTCCAGA
AGAGAAAGATGAAGATGACACCCCTGAAACCTGCATCTACTCCAACTGGTCCCCATGGTCGGCCTGCAGC
TCTTCCACTTGTGAAAAGGGCAAGAGGATGCGGCAGCGCATGCTGAAGGCACAGCTGGACCTCAGTGTCC
CCTGTCCTGACACCCAGGACTTCCAGCCCTGCATGGGCCCAGGCTGCAGCGATGAAGATGGCTCCACCTG
TACCATGTCGGAGTGGATCACCTGGTCGCCCTGTAGCGTCTCGTGCGGCATGGGCATGAGGTCCCGGGAG
AGATACGTGAAGCAGTTCCCGGAAGACGGCTCAGTGTGCATGCTGCCCACGGAGGAGACGGAGAAGTGCA
CAGTCAACGAGGAGTGCTCTCCTAGCAGCTGCCTGGTGACTGAGTGGGGTGAGTGGGACGACTGCAGTGC
CACCTGTGGGATGGGTATGAAGAAGAGGCACCGTATGGTCAAGATGAGCCCCGCGGACGGCTCCATGTGC
AAGGCAGAGACATCGCAGGCGGAGAAATGCATGATGCCTGAGTGCCATACCATCCCGTGCTTGCTGTCTC
CCTGGTCCGAGTGGAGCGACTGTAGCGTGACCTGTGGGAAGGGCATGCGGACCCGCCAGCGGATGCTCAA
ATCTCTGGCAGAGCTGGGTGACTGTAACGAGGACCTGGAGCAGGCGGAGAAGTGCATGCTGCCAGAATGC
CCCATTGACTGTGAACTCAGCGAGTGGTCCCAGTGGTCTGAATGTAACAAGTCATGTGGGAAAGGTCACA
TGATTCGAACCCGGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4221758), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 18636. Forward Primer - name:018636_F_IRAV28-31_F09_Spon1, sequence:CCCGGAAGGGAGAACAGT; Reverse Primer - name:018636_R_SP6_IRAV28-31_F09_Spon1, sequence:TGTCCGGGTTCGAATCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009887 same experiment
 EMAGE:31339 same embryo
 EMAGE:31582 same embryo
 EMAGE:31562 same embryo
 EMAGE:30447 same embryo
 EMAGE:31557 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS