Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31625

Nkx2-2 NK2 transcription factor related, locus 2 (Drosophila) ( MGI:97347)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31625 EMAGE:31625 EMAGE:31625 EMAGE:31625 EMAGE:31625
euxassay_008989_01 euxassay_008989_02 euxassay_008989_03 euxassay_008989_04 euxassay_008989_05
EMAGE:31625 EMAGE:31625 EMAGE:31625 EMAGE:31625 EMAGE:31625
euxassay_008989_06 euxassay_008989_07 euxassay_008989_08 euxassay_008989_09 euxassay_008989_10
EMAGE:31625 EMAGE:31625 EMAGE:31625 EMAGE:31625 EMAGE:31625
euxassay_008989_11 euxassay_008989_12 euxassay_008989_13 euxassay_008989_14 euxassay_008989_15
EMAGE:31625 EMAGE:31625 EMAGE:31625 EMAGE:31625 EMAGE:31625
euxassay_008989_16 euxassay_008989_17 euxassay_008989_18 euxassay_008989_19 euxassay_008989_20
EMAGE:31625 EMAGE:31625 EMAGE:31625 EMAGE:31625
euxassay_008989_21 euxassay_008989_22 euxassay_008989_23 euxassay_008989_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
weak weak
regionalweak expression: see section 05 06 07 08 09 12 13 14 15
pancreas
moderate moderate
regionalmoderate expression: see section 09 10 15 16 weak expression: see section 08 11 12 14
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 18 19 20
vagus x ganglion
weak weak
regionalweak expression: see section 07 16
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 16 17 18 19 20
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15
metencephalon rest of alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 11 15
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 11 15
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 05 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35501
Entity Detected:Nkx2-2, NK2 transcription factor related, locus 2 (Drosophila) ( MGI:97347)
Sequence:sense strand is shown

>T35501
CGATCCTTACCACGGTTGTTATTATTATTATTATAATTATTATTAAAGAGTCGAGTCTGACTTTCGACTC
AGTTGAGGAGGCACAGGGAGGTTGCCTGTGCCTCCCCGAGTGGCAGATTCCATTGACTCTGCCCCATCGC
TCTCCCCTTTGAACTTTTGGAGAGGATAGAACTCTAAGCCGTGTTTACAGAATGTTGTGCAGCTTTGCTT
CTTTGCCTCTCTCTCCCTGAGGGGACCAAACCATCCCAACGTTAACGTTGTCACTTGAAAAGAGAAAGGA
CCAACCGGCCCCCACCCCACCCCACCCCCCGCACTGCTTTCGTGAATTTTGTAAACTATGTTTGTGTGAG
TAGCGATATTGTCAGCCTTCTAAAAGCAAGTGGAGAACACTTTAAAATATAGAGGATTTCTTTTTTTATA
AGAAAATGCTAAATATTTATGGCCATGTACACGTTCTGACAACTGGTGGCAAATTTCGCTCCTTCGTTGT
AAATATCGCTAGTGATCGTTGCCAAATGACGTTCTGGATGGGCCTGTATCCCCACCGGGCCTGCCTCTCT
TTGTCGTTTGTTTTCGGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99269. Forward Primer - name:099269_F_cDNA_Nkx2-2, sequence:CGATCCTTACCACGGTTGTTAT; Reverse Primer - name:099269_N_SP6_cDNA_Nkx2-2, sequence:CACCGAAAACAAACGACAAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008989 same experiment
 EMAGE:31640 same embryo
 EMAGE:30524 same embryo
 EMAGE:30512 same embryo
 EMAGE:31632 same embryo
 EMAGE:30521 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS