Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31644

Pawr PRKC, apoptosis, WT1, regulator ( MGI:2149961)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31644 EMAGE:31644 EMAGE:31644 EMAGE:31644 EMAGE:31644
euxassay_014184_01 euxassay_014184_02 euxassay_014184_03 euxassay_014184_04 euxassay_014184_05
EMAGE:31644 EMAGE:31644 EMAGE:31644 EMAGE:31644 EMAGE:31644
euxassay_014184_06 euxassay_014184_07 euxassay_014184_08 euxassay_014184_09 euxassay_014184_10
EMAGE:31644 EMAGE:31644 EMAGE:31644 EMAGE:31644 EMAGE:31644
euxassay_014184_11 euxassay_014184_12 euxassay_014184_13 euxassay_014184_14 euxassay_014184_15
EMAGE:31644 EMAGE:31644 EMAGE:31644 EMAGE:31644 EMAGE:31644
euxassay_014184_16 euxassay_014184_17 euxassay_014184_18 euxassay_014184_19 euxassay_014184_20
EMAGE:31644 EMAGE:31644 EMAGE:31644 EMAGE:31644
euxassay_014184_21 euxassay_014184_22 euxassay_014184_23 euxassay_014184_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 21 22 23 24
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 11 12 13
right lung
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19 20 moderate expression: see section 21 22
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 11 12 13
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 14 15 16 17
urethra of male
strong strong
regionalstrong expression: see section 13 14 15
left lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11
bladder
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 12
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 15 16 17 18
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 13 14 15 16 17 18 weak expression: see section 02 03 04 19 20 21
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 13 14 15 moderate expression: see section 16
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40515
Entity Detected:Pawr, PRKC, apoptosis, WT1, regulator ( MGI:2149961)
Sequence:sense strand is shown

>T40515
GATATCCCCGAACAGACAGAAGTGGTTTCAGTAGACACAACAGAGATGCAAATGCGCCGGCTAGTTTCTC
CTCAAGTAGCACCTTGGAAAAGAGAATTGAAGATCTTGAAAAGGAAGTTGTAAGAGAAAGGCAAGAAAAC
CTTCGACTTGTGAGGCTGATGCAAGATAAAGAAGAAATGATTGGGAAACTCAAGGAAGAGATCGATTTGT
TAAATAGAGACCTAGATGACATGGAAGATGAGAACGAGCAACTAAAACAGGAAAATAAAACTCTTTTGAA
GGTTGTTGGGCAGCTGACAAGGTAGAAGCTGCACGGGCGGCTTCGGTGTGGAAAGCCTGCTTTTACACTA
CTGATGAATGTCATGGCTAAGGCTGAGCTGAGACGCCTGTGATTCACTGCGTTGTTGAGAGGACTGTATA
TTTATTTCTAGAAAACACGTGGATTTTTTTTTCAAGATTCACTCTTTCATTGCTAGTTTCTAAAAAGTAT
TAAGCCCTGTATTTCACATAGAAGTAACGTTTTTAGTTATTAAAGTCATAGGTAATGCCTCTTGGTTTTG
TGTGATATCCAGATAATATATGGTTCAAAGTAACAGCCATTTGCATATATTTTATCTACGTTAGCCCATA
TTCTCCCTAAAGGAATATGCATAGTCTTTGTTTACATGAATTCACATCCTTGGGGGAGTTGGCCTACAAT
GCCTTATT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 163002. Forward Primer - name:163002_F_cDNA_mCG16868.2, sequence:GATATCCCCGAACAGACAGAAG; Reverse Primer - name:163002_N_SP6_cDNA_mCG16868.2, sequence:AATAAGGCATTGTAGGCCAACT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_014184 same experiment
 EMAGE:29616 same embryo
 EMAGE:29410 same embryo
 EMAGE:29555 same embryo
 EMAGE:31624 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS