Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31769

Gsta4 glutathione S-transferase, alpha 4 ( MGI:1309515)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31769 EMAGE:31769 EMAGE:31769 EMAGE:31769 EMAGE:31769
euxassay_001978_01 euxassay_001978_02 euxassay_001978_03 euxassay_001978_04 euxassay_001978_05
EMAGE:31769 EMAGE:31769 EMAGE:31769 EMAGE:31769 EMAGE:31769
euxassay_001978_06 euxassay_001978_07 euxassay_001978_08 euxassay_001978_09 euxassay_001978_10
EMAGE:31769 EMAGE:31769 EMAGE:31769 EMAGE:31769 EMAGE:31769
euxassay_001978_11 euxassay_001978_12 euxassay_001978_13 euxassay_001978_14 euxassay_001978_15
EMAGE:31769 EMAGE:31769 EMAGE:31769 EMAGE:31769 EMAGE:31769
euxassay_001978_16 euxassay_001978_17 euxassay_001978_18 euxassay_001978_19 euxassay_001978_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
olfactory cortex ventricular layer
weak weak
regionalweak expression: see section 14 15 not examined expression: see section 16 17
stomach
strong strong
regionalstrong expression: see section 01 02 09
pons ventricular layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 12
4th ventricle lateral recess
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 14 15 16 moderate expression: see section 10 11 12 13 17
rest of cerebellum marginal layer
weak weak
regionalweak expression: see section 05 06 07 08 13 14 15 16
testis
moderate moderate
regionalmoderate expression: see section 03 04 05 13 14 15
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 13 14 15 16 17
cochlea
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 13 14 15 16
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10
bladder
moderate moderate
regionalmoderate expression: see section 11
esophagus
moderate moderate
regionalmoderate expression: see section 09 10
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 14 15
trachea
weak weak
regionalweak expression: see section 10 11
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11
stomach fundus
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 10
telencephalon ventricular layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 10 11 12
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 06 07 08 09 14 15 16 moderate expression: see section 10 11 12 13
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 11 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T693
Entity Detected:Gsta4, glutathione S-transferase, alpha 4 ( MGI:1309515)
Sequence:sense strand is shown

>T693
TCCTCGAGNCTGTTGGCCTACTGGAGAACCGCTTCTTTCCAGTGCCTGGAGACAACAATCCCACAAGAAT
AAGGAAGCTCTGAAGCAGGAGTCATGGCAGCCAAACCTAAGCTCTACTACTTTAATGGCAGGGGACGGAT
GGAGTCGATCCGCTGGCTGCTGGCTGCGGCTGGAGTGGAGTTTGAGGGAGAATTTCTTGAGACAAGGGAA
CAGTATGAGAAGATGCAAAAGGATGGACACCTGCTTTTCGGCCAAGTACCCTTGGTTGAAATCGATGGGA
TGATGCTGACACAGACCAGGGCCATCCTCAGCTACCTCGCTGCCAAGTACAACTTGTATGGGAAGGACCT
GAAGGAGAGAGTCAGGATTGACATGTATGCAGATGGCACCCAGGACCTGATGATGATGATTGCCGTGGCT
CCATTTAAAACCCCCAAGGAAAAAGAGGAGAGCTATGATTTGATACTGTCAAGAGCTAAAACCCGTTACT
TCCCAGTGTTTGAAAAGATTTTAAAAGACCACGGAGAGGCTTTTCTCGTTGGCAACCAGC
Notes:The probe template was PCR amplified from IMAGE:1889069 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1889069 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001978 same experiment
 EMAGE:30558 same embryo
 EMAGE:30581 same embryo
 EMAGE:30608 same embryo
 EMAGE:31833 same embryo
 EMAGE:30610 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS