Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31776

Erbb2 ( MGI:95410)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31776 EMAGE:31776 EMAGE:31776 EMAGE:31776 EMAGE:31776
euxassay_006184_01 euxassay_006184_02 euxassay_006184_03 euxassay_006184_04 euxassay_006184_05
EMAGE:31776 EMAGE:31776 EMAGE:31776 EMAGE:31776 EMAGE:31776
euxassay_006184_06 euxassay_006184_07 euxassay_006184_08 euxassay_006184_09 euxassay_006184_10
EMAGE:31776 EMAGE:31776 EMAGE:31776 EMAGE:31776 EMAGE:31776
euxassay_006184_11 euxassay_006184_12 euxassay_006184_13 euxassay_006184_14 euxassay_006184_15
EMAGE:31776 EMAGE:31776 EMAGE:31776 EMAGE:31776 EMAGE:31776
euxassay_006184_16 euxassay_006184_17 euxassay_006184_18 euxassay_006184_19 euxassay_006184_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
oral epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 19 20 moderate expression: see section 17 18
heart ventricle
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14
rectum
strong strong
regionalstrong expression: see section 12 13
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 05 06 08 09 10 11 13 14 15 16 17 18 19 moderate expression: see section 20
bladder
strong strong
regionalstrong expression: see section 11 12
diaphragm
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 17 18 19 20 weak expression: see section 14 15 16
eye skeletal muscle
moderate moderate
regionalmoderate expression: see section 05 06 07 08 20
lower jaw molar
strong strong
regionalstrong expression: see section 06 moderate expression: see section 17 18
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 14 15 16 17 18 19 20
upper jaw molar
strong strong
regionalstrong expression: see section 06
leg muscle
moderate moderate
spottedmoderate expression: see section 03 04 05 06 07 08 09 18 19
vertebral axis musculature
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
lower leg rest of mesenchyme
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05
posterior naris
strong strong
regionalstrong expression: see section 12 16
frenulum
strong strong
regionalstrong expression: see section 13
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 20
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
external naris
strong strong
regionalstrong expression: see section 12 16
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 15 16 17 moderate expression: see section 18 19
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
esophagus epithelium
strong strong
regionalstrong expression: see section 09 10
eyelid
strong strong
regionalstrong expression: see section 02 03 04 05
tongue epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
larynx
strong strong
regionalstrong expression: see section 10 11
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08
pons ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 moderate expression: see section 20
urethra of male
strong strong
regionalstrong expression: see section 12 13
anterior naris
strong strong
regionalstrong expression: see section 12 13 15 16
tail paraxial mesenchyme
moderate moderate
spottedmoderate expression: see section 12 14 15 16 17 18 19 20
tongue muscle
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
midgut
strong strong
regionalstrong expression: see section 09 10 11
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 08 09 10
submandibular gland primordium
strong strong
regionalstrong expression: see section 05 06 07 08 14 15 16 17
naso-lacrimal duct
strong strong
regionalstrong expression: see section 05 09 10 moderate expression: see section 06 07 08 18 19 20
pharynx epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13
lower jaw incisor
strong strong
regionalstrong expression: see section 10 14 15
upper jaw incisor
strong strong
regionalstrong expression: see section 11 15
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T503
Entity Detected:Erbb2, ( MGI:95410)
Sequence:sense strand is shown

>T503
TCTCGACACTGTTGGCCTACTGGAGNTGCCCGCCGCTGGGGACCCGGAGCCCAGGAGCGCCCCTTCCCAG
GCGGCCCCTTCCGGCGCCGCGCCTGTGCCTGCCCTCGCCGCGCCCCGCGCCCGCAGCCTGGTCCAGCCTG
AGCCATGGGGCCGGAGCCGCAGTGATCATCATGGAGCTGGCGGCCTGGTGCCGTTGGGGGTTCCTCCTCG
CCCTCCTGTCCCCCGGAGCCGCGGGTACCCAAGTGTGTACCGGTACCGACATGAAGTTGCGACTCCCTGC
CAGTCCTGAGACCCACCTGGACATGCTTCGCCACCTCTACCAGGGCTGTCAGGTGGTGCAGGGCATTTGG
AGCTTACCTACCTGCCCGCCAATGCCAGCCTCTCATTCCTGCAGGACATCCAGGAAGTCCAGGGATACAT
GCTCATCGCTCACAACCGAGTGAAACACGTCCCACTGCAGAGGTTGCGCATCGTGAGAGGGACTCAGCTC
TTTGAGGACAAGTATGCCCTGGCTGTGCTAGACAACCGAGACCCTTTGGACAACGT
Notes:The probe template was PCR amplified from IMAGE:1481692 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1481692 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006184 same experiment
 EMAGE:31791 same embryo
 EMAGE:30915 same embryo
 EMAGE:30805 same embryo
 EMAGE:31810 same embryo
 EMAGE:30874 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS