Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31802

Pdpk1 ( MGI:1338068)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31802 EMAGE:31802 EMAGE:31802 EMAGE:31802 EMAGE:31802
euxassay_001988_01 euxassay_001988_02 euxassay_001988_03 euxassay_001988_04 euxassay_001988_05
EMAGE:31802 EMAGE:31802 EMAGE:31802 EMAGE:31802 EMAGE:31802
euxassay_001988_06 euxassay_001988_07 euxassay_001988_08 euxassay_001988_09 euxassay_001988_10
EMAGE:31802 EMAGE:31802 EMAGE:31802 EMAGE:31802 EMAGE:31802
euxassay_001988_11 euxassay_001988_12 euxassay_001988_13 euxassay_001988_14 euxassay_001988_15
EMAGE:31802 EMAGE:31802 EMAGE:31802 EMAGE:31802 EMAGE:31802
euxassay_001988_16 euxassay_001988_17 euxassay_001988_18 euxassay_001988_19 euxassay_001988_20
EMAGE:31802 EMAGE:31802 EMAGE:31802
euxassay_001988_21 euxassay_001988_22 euxassay_001988_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 11 12 13 14 15
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 18 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 08 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 15 16 17 18 19 20
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 16
spinal cord
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1142
Entity Detected:Pdpk1, ( MGI:1338068)
Sequence:sense strand is shown

>T1142
TCCTCGAGNCTGTTGGCCTACTGGTTTGCTGGGGCTCCGCCGCGGGGAGGAGGACGCTGAGGAGGCGCCG
AGCAGCGCAACGCTGCGGGGGAGGCGCCCGCGCCGACTTGGGGCTCATAGCCAGGACCACCAGTCCAGCT
GTATGACGCTGTGCCCATTCTGTCCAGTGTGGTGCTATGTTCCTGCCCATCCCCATCAATGGTGAGGTCC
CAGACTGAGCCCGGTTCGTCCCCTGGCATTCCTAGTGGTGTTAGCAGGCAGGGATCCACCATGGATGGCA
CCACAGCTGAAGCCCGACCAAGCACCAACCCCTATGGCAGCACCCTGCCCAGCTGCCACCACAGCCTCGC
AAGAAACGCCCTGAAGACTTCAAGTTTGGGAAAATTCTTGGCGAGGGCTCTTTTTCAACAGTTGTTCTGG
CCCGAGAACTGGCCACTTCCAGAGAATATGCTATTAAAATTCTGGAGAAACGTCATATTATAAAAGAAAA
CAAAGTTCCGTATGTAACTAGAGAGAGAGATGTGATGTCACGCCTGGATCACCCCTTCTTTGTGAAACTT
TATTTTACATTTCAGGA
Notes:The probe template was PCR amplified from IMAGE:2135930 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2135930 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001988 same experiment
 EMAGE:31010 same embryo
 EMAGE:30575 same embryo
 EMAGE:31794 same embryo
 EMAGE:29315 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS