Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31902

Strap serine/threonine kinase receptor associated protein ( MGI:1329037)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31902 EMAGE:31902 EMAGE:31902 EMAGE:31902 EMAGE:31902
euxassay_009444_01 euxassay_009444_02 euxassay_009444_03 euxassay_009444_04 euxassay_009444_05
EMAGE:31902 EMAGE:31902 EMAGE:31902 EMAGE:31902 EMAGE:31902
euxassay_009444_06 euxassay_009444_07 euxassay_009444_08 euxassay_009444_09 euxassay_009444_10
EMAGE:31902 EMAGE:31902 EMAGE:31902 EMAGE:31902 EMAGE:31902
euxassay_009444_11 euxassay_009444_12 euxassay_009444_13 euxassay_009444_14 euxassay_009444_15
EMAGE:31902 EMAGE:31902 EMAGE:31902 EMAGE:31902 EMAGE:31902
euxassay_009444_16 euxassay_009444_17 euxassay_009444_18 euxassay_009444_19 euxassay_009444_20
EMAGE:31902 EMAGE:31902 EMAGE:31902 EMAGE:31902
euxassay_009444_21 euxassay_009444_22 euxassay_009444_23 euxassay_009444_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 08 15
clavicle
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 09
pancreas
weak weak
regionalweak expression: see section 07 08 09 10 11
facial vii ganglion
weak weak
regionalweak expression: see section 04 05
lower jaw molar
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 08 10
upper jaw molar
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 08
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
thymus primordium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 17 18 19 20 21
vibrissa
weak weak
regionalweak expression: see section 09 10 11 22 23
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 weak expression: see section 01 23
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16 17 18 19 20 21
cervical ganglion
weak weak
regionalweak expression: see section 07 08 16
neural retina
weak weak
regionalweak expression: see section 03 04 24
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 19 weak expression: see section 12 13 14 17 18
pons mantle layer
weak weak
regionalweak expression: see section 07 16
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 11 14 15 16
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 07 08 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 16 17 18 19 weak expression: see section 06
vomeronasal organ
weak weak
regionalweak expression: see section 11 14 17
renal cortex
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 15 16 17 18 19
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 12 13 14
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 17 18 19 weak expression: see section 13 14 15
lung
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 13 14 15 16 17 18 19 20
diencephalon lateral wall ventricular layer
weak weak
homogeneousweak expression: see section 12 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36860
Entity Detected:Strap, serine/threonine kinase receptor associated protein ( MGI:1329037)
Sequence:sense strand is shown

>T36860
GTGGATTTCACACAGGATAGCAATTACCTGCTAACTGGGGGACAGGATAAACTGCTGCGCATATATGACT
TGAACAAACCTGAAGCAGAACCTAAGGAAATCAGTGGCCACACTTCTGGTATTAAAAAGGCTCTGTGGTG
CAGTGACGATAAACAGATCCTTTCAGCGGATGATAAAACTGTTCGGCTCTGGGATCATGCCACAATGACA
GAAGTGAAATCTCTGAATTTTAATATGTCTGTTAGCAGCATGGAGTATATTCCTGAAGGAGAGATTTTGG
TTATTACTTATGGACGATCTATTGCTTTTCATAGTGCAGTAAGTCTGGAGCCAATTAAATCCTTTGAAGC
TCCTGCGACCATCAATTCTGCGTCTCTTCATCCAGAGAAGGAGTTTCTTGTTGCGGGTGGAGAAGACTTT
AAACTGTACAAGTATGATTATAACAGTGGAGAAGAGTTAGAATCCTACAAAGGTCACTTTGGTCCCATTC
ACTGTGTGAGATTCAGTCCTGATGGGGAACTCTATGCCAGCGGTTCTGAAGATGGGACATTGAGATTGTG
GCAAACTGTGGTAGGAAAGACCTATGGCCTGTGGAAATGCGTGCTTCCTGAGGAAGACAGCGGGGAACTG
GCAAAGCCAAAGATCGGATTTCCAGAAACAGCAGAGGAAGAGCTGGCAGAAGAAATTGCTTCAGAGAATT
CAGATTCCATCTATTCATCAACTCCTGAAGTTAAGGCCTGAGCATCAGACGTGTGCTGCCGAAACCATAT
GTTCATGGACTAAACAAGCAGAGACAAGCATCCGCCTTCAGAGTTACTGTCTGCCTGAGGCAAAGAGGGC
AGAAAATATTGGGGCATATGAGTTAGCTCCAGTGCACGAACAGCTACTCAGTGTTGCCCGTGAGTGAAAA
TGGCTGAGTGTCTGAGGTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99489. Forward Primer - name:099489_F_cDNA_Strap, sequence:GTGGATTTCACACAGGATAGCA; Reverse Primer - name:099489_N_SP6_cDNA_Strap, sequence:GCACCTCAGACACTCAGCCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009444 same experiment
 EMAGE:30426 same embryo
 EMAGE:31900 same embryo
 EMAGE:30569 same embryo
 EMAGE:31793 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS