Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31936

Fgfbp3 fibroblast growth factor binding protein 3 ( MGI:1919764)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31936 EMAGE:31936 EMAGE:31936 EMAGE:31936 EMAGE:31936
euxassay_000173_01 euxassay_000173_02 euxassay_000173_03 euxassay_000173_04 euxassay_000173_05
EMAGE:31936 EMAGE:31936 EMAGE:31936 EMAGE:31936 EMAGE:31936
euxassay_000173_06 euxassay_000173_07 euxassay_000173_08 euxassay_000173_09 euxassay_000173_10
EMAGE:31936 EMAGE:31936 EMAGE:31936 EMAGE:31936 EMAGE:31936
euxassay_000173_11 euxassay_000173_12 euxassay_000173_13 euxassay_000173_14 euxassay_000173_15
EMAGE:31936 EMAGE:31936 EMAGE:31936 EMAGE:31936 EMAGE:31936
euxassay_000173_16 euxassay_000173_17 euxassay_000173_18 euxassay_000173_19 euxassay_000173_20
EMAGE:31936 EMAGE:31936 EMAGE:31936
euxassay_000173_21 euxassay_000173_22 euxassay_000173_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
not examined not examined
homogeneousnot examined expression: see section 09
medulla oblongata floor plate
strong strong
homogeneousstrong expression: see section 10 13
metencephalon basal plate
strong strong
homogeneousstrong expression: see section 06 08 09 10 11 12 13 14 15 17
ventral grey horn
strong strong
single cellstrong expression: see section 08 13
medulla oblongata basal plate ventricular layer
strong strong
homogeneousstrong expression: see section 10 11 12 13 15
basal columns
strong strong
single cellstrong expression: see section 10
not examined not examined
homogeneousnot examined expression: see section 08 09 10 11
pons ventricular layer
strong strong
homogeneousstrong expression: see section 08 09 10 11 12 13 14 15 17
spinal cord
strong strong
single cellstrong expression: see section 08
cerebral cortex ventricular layer
strong strong
gradedstrong expression: see section 12 moderate expression: see section 02 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 10 11 12 13 14 15
midbrain floor plate
strong strong
homogeneousstrong expression: see section 13 not examined expression: see section 08 09 11
medulla oblongata basal plate
strong strong
homogeneousstrong expression: see section 15
spinal cord floor plate
strong strong
homogeneousstrong expression: see section 13 not examined expression: see section 10
diencephalon floor plate
strong strong
homogeneousstrong expression: see section 12
midbrain ventricular layer
strong strong
homogeneousstrong expression: see section 06 08 09 10 11 12 13 14 15
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 15
corpus striatum
strong strong
gradedstrong expression: see section 02 04 05 06 07 09 19 20 21 moderate expression: see section 08 10 11 13 14 16 17 18 22 23
diencephalon lateral wall ventricular layer
strong strong
homogeneousstrong expression: see section 10 12 13 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1590
Entity Detected:Fgfbp3, fibroblast growth factor binding protein 3 ( MGI:1919764)
Sequence:sense strand is shown

>T1590
GCCGAGCTCACTGAGACCTACTGCACCGAGAAGTGGCATTCCCTTTGCAACTTCTTTGTCAACTTCTGGA
ATGGCTGAGGCTGCGGGCTGGCAAGGGGCACTAGGGGTAGGTGCTGAGAAGCAGAGGGTAGCGCAGCCGA
GGCGGGAGATGTCCTTGGACAGGGAACCGGGATGGAGAATAAGCTAGTCGGCTAGTCGGGATTCCAAAAT
GGGTCAGGGGTCAGGGTAAGAAGAATCTGAAGCAGCTGGAGAGGGCTTTTGTTTTTTATTTTATGTTTAT
TTTTATTTTTTAAAGCATCTCAGCTCTGATTTAAGAGCAGAAGAAAAAGTGGAAACAAATAGATTTATAT
CAAGTATGGGAAAATTGTAGACTAGGGAGAGAAGCTGAGACTAGCAAGAATGAAGTGACTAAAGAGGTGA
GAATCTTTCCTAGGAAGTGGGATACAATGTATATCAACACATTTTCATTAAATGTAACTGTGAGTAAGAA
CCTGAACCATGTTGAATATTTCAAGATCTTCTTGGTTTT
Notes:The probe template was PCR amplified from IMAGE:988495 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:988495 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000173 same experiment
 EMAGE:31419 same embryo
 EMAGE:30637 same embryo
 EMAGE:30635 same embryo
 EMAGE:30780 same embryo
 EMAGE:31420 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS