Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32083

Zfhx3 zinc finger homeobox 3 ( MGI:99948)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32083 EMAGE:32083 EMAGE:32083 EMAGE:32083 EMAGE:32083
euxassay_016590_01 euxassay_016590_02 euxassay_016590_03 euxassay_016590_04 euxassay_016590_05
EMAGE:32083 EMAGE:32083 EMAGE:32083 EMAGE:32083 EMAGE:32083
euxassay_016590_06 euxassay_016590_07 euxassay_016590_08 euxassay_016590_09 euxassay_016590_10
EMAGE:32083 EMAGE:32083 EMAGE:32083 EMAGE:32083 EMAGE:32083
euxassay_016590_11 euxassay_016590_12 euxassay_016590_13 euxassay_016590_14 euxassay_016590_15
EMAGE:32083 EMAGE:32083 EMAGE:32083 EMAGE:32083 EMAGE:32083
euxassay_016590_16 euxassay_016590_17 euxassay_016590_18 euxassay_016590_19 euxassay_016590_20
EMAGE:32083 EMAGE:32083
euxassay_016590_21 euxassay_016590_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 02
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 07 13
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 16 17 18
axial skeleton
weak weak
regionalweak expression: see section 11 12 13
axial skeleton tail region
weak weak
regionalweak expression: see section 11 12 13
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 16 17 weak expression: see section 12 14
thoracic ganglion
weak weak
regionalweak expression: see section 11
viscerocranium
moderate moderate
regionalmoderate expression: see section 04 05 06 07 16 17 18
interdigital region between hindlimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 01
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 04 05 17 18
vagus x ganglion
weak weak
single cellweak expression: see section 07
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 02
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 17 18 weak expression: see section 06 07 16
cervical ganglion
weak weak
regionalweak expression: see section 07 08
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 07 08 09 10 11 13 14 16 17 18 weak expression: see section 03 06 12 15
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 16 17 18
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 03 04 05 17 18 weak expression: see section 01 02 19 20 21
neural retina
weak weak
regionalweak expression: see section 01 02 19 20
cornea
weak weak
regionalweak expression: see section 01 21 22
interdigital region between hindlimb digits 4 and 5
moderate moderate
regionalmoderate expression: see section 01
ventral grey horn
moderate moderate
regionalmoderate expression: see section 08 09 10 13 weak expression: see section 11 12 14
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 02
head mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 18 19 20 21 22
vault of skull
weak weak
regionalweak expression: see section 01 02 19 20 21
interdigital region between hindlimb digits 3 and 4
moderate moderate
regionalmoderate expression: see section 01
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 03 22
glossopharyngeal ix ganglion
weak weak
single cellweak expression: see section 16
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 02
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 13 14 16 17
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 14 weak expression: see section 12
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 08 weak expression: see section 06 07 14
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 13 16 weak expression: see section 12 14
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 20 21 22
interdigital region between hindlimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 01
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 weak expression: see section 15
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 14 16 weak expression: see section 12 15
glans of male genital tubercle
weak weak
regionalweak expression: see section 09 10 11 13
exoccipital bone
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 01 02 20 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45043
Entity Detected:Zfhx3, zinc finger homeobox 3 ( MGI:99948)
Sequence:sense strand is shown

>T45043
AGTGATCAAGCACTGGTTCAGAAACACTCTATTCAAGGAGCGGCAACGGAACAAGGACTCCCCGTACAAC
TTCAGCAACCCTCCCATCACCAGTCTGGAGGAACTCAAGATCGACTCCCGGCCCCCTTCCCCCGAACCCC
AGAAGCAGGAGTACTGGGGGAGCAAGCGGTCCTCGAGAACAAGGTTTACCGACTACCAGCTCCGAGTCCT
GCAAGACTTCTTTGATGCCAATGCTTACCCAAAGGATGATGAATTTGAGCAGCTTTCTAACTTACTGAAC
CTTCCAACCCGTGTCATAGTGGTGTGGTTTCAGAACGCCCGACAGAAAGCCAGGAAGAATTACGAGAATC
AGGGGGAGGGCAAAGACGGAGAGCGGCGCGAGCTTACCAACGATCGCTACATTCGGACGAGCAACTTGAA
TTACCAGTGCAAAAAGTGCAGCCTCGTGTTTCAGCGCATCTTTGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 166573166573. Forward Primer - name:166573_F_Atbf1, sequence:AGTGATCAAGCACTGGTTCAGA; Reverse Primer - name:166573_R_SP6_Atbf1, sequence:GTCAAAGATGCGCTGAAACAC.The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016590 same experiment
 EMAGE:32086 same embryo
 EMAGE:32087 same embryo
 EMAGE:32089 same embryo
 EMAGE:32082 same embryo
 EMAGE:32090 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS