Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32086

Grin2a ( MGI:95820)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32086 EMAGE:32086 EMAGE:32086 EMAGE:32086 EMAGE:32086
euxassay_016594_01 euxassay_016594_02 euxassay_016594_03 euxassay_016594_04 euxassay_016594_05
EMAGE:32086 EMAGE:32086 EMAGE:32086 EMAGE:32086 EMAGE:32086
euxassay_016594_06 euxassay_016594_07 euxassay_016594_08 euxassay_016594_09 euxassay_016594_10
EMAGE:32086 EMAGE:32086 EMAGE:32086 EMAGE:32086 EMAGE:32086
euxassay_016594_11 euxassay_016594_12 euxassay_016594_13 euxassay_016594_14 euxassay_016594_15
EMAGE:32086 EMAGE:32086 EMAGE:32086 EMAGE:32086 EMAGE:32086
euxassay_016594_16 euxassay_016594_17 euxassay_016594_18 euxassay_016594_19 euxassay_016594_20
EMAGE:32086 EMAGE:32086 EMAGE:32086 EMAGE:32086
euxassay_016594_21 euxassay_016594_22 euxassay_016594_23 euxassay_016594_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cranial muscle
moderate moderate
regionalmoderate expression: see section 01 22 23 24 weak expression: see section 02 03 20 21
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 01
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
extrinsic ocular muscle
weak weak
regionalweak expression: see section 02 03 04 05 06 07 20 21 22
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 02
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 01
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 05 06 20
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 03
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 07 08 16
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 02
pons mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 05 06 07 08 16 20
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 08 16
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 21 22 23 24
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 02
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 11 12 13 14 weak expression: see section 10 15 16
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 08 09 10 11 12 13 14 15 16 weak expression: see section 06 07 20 21
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 20
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45080
Entity Detected:Grin2a, ( MGI:95820)
Sequence:sense strand is shown

>T45080
CAGCTGAAGAAGATCCACTCCTCTGTCATCCTGCTCTACTGCTCCAAGGATGAGGCTGTCCTCATCCTGA
GCGAGGCTCGCTCTCTTGGCCTCACCGGCTACGATTTCTTCTGGATTGTCCCCAGTTTGGTCTCCGGGAA
CACAGAGCTCATCCCCAAAGAGTTTCCATCGGGTCTCATTTCAGTCTCTTACGACGACTGGGACTACAGT
CTGGAGGCAAGAGTGAGAGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 171838171838. Forward Primer - name:171838_F_Grin2a, sequence:CAGCTGAAGAAGATCCACTCCT; Reverse Primer - name:171838_R_SP6_Grin2a, sequence:GTCTCTCACTCTTGCCTCCAG.The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016594 same experiment
 EMAGE:32087 same embryo
 EMAGE:32089 same embryo
 EMAGE:32082 same embryo
 EMAGE:32083 same embryo
 EMAGE:32090 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS