Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32090

Runx1t1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) ( MGI:104793)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32090 EMAGE:32090 EMAGE:32090 EMAGE:32090 EMAGE:32090
euxassay_016597_01 euxassay_016597_02 euxassay_016597_03 euxassay_016597_04 euxassay_016597_05
EMAGE:32090 EMAGE:32090 EMAGE:32090 EMAGE:32090 EMAGE:32090
euxassay_016597_06 euxassay_016597_07 euxassay_016597_08 euxassay_016597_09 euxassay_016597_10
EMAGE:32090 EMAGE:32090 EMAGE:32090 EMAGE:32090 EMAGE:32090
euxassay_016597_11 euxassay_016597_12 euxassay_016597_13 euxassay_016597_14 euxassay_016597_15
EMAGE:32090 EMAGE:32090 EMAGE:32090 EMAGE:32090 EMAGE:32090
euxassay_016597_16 euxassay_016597_17 euxassay_016597_18 euxassay_016597_19 euxassay_016597_20
EMAGE:32090 EMAGE:32090 EMAGE:32090
euxassay_016597_21 euxassay_016597_22 euxassay_016597_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
midbrain mantle layer
weak weak
regionalweak expression: see section 09 10 11 17 18 19
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 09 10 11 14 15 16 17 18
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 09 10 14 15 16
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 18 19 weak expression: see section 07 08 09 17
dorsal grey horn
weak weak
regionalweak expression: see section 10 11 12 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45052
Entity Detected:Runx1t1, runt-related transcription factor 1; translocated to, 1 (cyclin D-related) ( MGI:104793)
Sequence:sense strand is shown

>T45052
TTCCAGTGCGGTGTATGACTACAGCAGCAAGAAAAAAAAATGCCATAATACAAAGGCTCCTTTTTATATA
TATAGTTATAGTCACCCACACACACACACACACACACACACACACACACACACACACACTTAAGAGACTC
AGCCTGCAGTTAATTAGCATTCTGGCAGCTTCCAAGTCAGCCAGCTGCCCTAAATAACCCTTCAACATTT
CTTCACTTTTGCAAGGTTCCACAGACTAAGACATTGGGTCTATTCCAGCTCATTCATTTTATATTGAAAA
CTAATTTAAAAAAAAATGGTGGCTTCAGCTCCAGCCCCTTTCCAAAATTTTTCAACCCCACCCTGTTTGG
ATTTTTAATTAAAATCTAGTAGTTCTCTTGGTATTAAAACACTTCTGTCCTGTGAGGTTTTCCCAATGGT
GTTTTTCTTGTAAATGTGTTGGACAAATGTGAAGATGCGTTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 166898166898. Forward Primer - name:166898_F_Cbfa2t1h, sequence:TTCCAGTGCGGTGTATGACTAC; Reverse Primer - name:166898_R_SP6_Cbfa2t1h, sequence:CAACGCATCTTCACATTTGTC.The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016597 same experiment
 EMAGE:32086 same embryo
 EMAGE:32087 same embryo
 EMAGE:32089 same embryo
 EMAGE:32082 same embryo
 EMAGE:32083 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS