EMAGE mouse gene expression spatial database

EMAGE:6410

Cul1 cullin 1 ( MGI:1349658)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_007276. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_007276_01	euxassay_007276_02	euxassay_007276_03	euxassay_007276_04

euxassay_007276_05	euxassay_007276_06	euxassay_007276_07	euxassay_007276_08	euxassay_007276_09

euxassay_007276_10	euxassay_007276_11	euxassay_007276_12	euxassay_007276_13	euxassay_007276_14

euxassay_007276_15	euxassay_007276_16	euxassay_007276_17	euxassay_007276_18	euxassay_007276_19

euxassay_007276_20	euxassay_007276_21	euxassay_007276_22

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

telencephalon ventricular layer

moderate

regional

moderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T2970
Entity Detected:	Cul1, cullin 1 ( MGI:1349658)
Sequence:	sense strand is shown >T2970 GGCCTCNAGCCAGATTCGGCACGAGGGTCTGCATGACCCACAAGCAGATAGTTCCAGTGAATAAAATGGA AACAACTCAAGTTCATAGCAGCCAGCCTGCCGCCATTTGGACCTTCATTTTTAAAGCTGAGACCACAGTT CCCACCAGCTGGTTTCAGGCTACAGCAGGACTGCTCAGGACTGACTGACACATTTCAGTCTGTAAACAGA CGCCAATGCCATTTACCCTAACTCACAGACAGAGGGGAACCGAACCTTCCATGCTGAGGCTGCATGCTAC CGCACTTAAATCAATACATTGGCTCCCTGGTTAACAGCTGTCGTCTGAGGCAGCACACGAGAGCGAGTCT GAATGGACCCACGTGTAATCTGCTATGAAAACCATTTGTATAGTGTGTTTCATTTTTTTAATGTGTGAAA ATAAAGAAAATTAAAGGAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:1532459 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1532459 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:6414 same embryo
	EMAGE:6409 same embryo
	EMAGE:6412 same embryo
	EMAGE:6411 same embryo
	EMAGE:6413 same embryo
	EurExpress:euxassay_007276 same experiment
	MGI:4824123 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source