Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6438

Dnase2b deoxyribonuclease II beta ( MGI:1913283)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6438 EMAGE:6438 EMAGE:6438 EMAGE:6438 EMAGE:6438
"Pseudo-wholemount" of euxassay_016390. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016390_01 euxassay_016390_02 euxassay_016390_03 euxassay_016390_04
EMAGE:6438 EMAGE:6438 EMAGE:6438 EMAGE:6438 EMAGE:6438
euxassay_016390_05 euxassay_016390_06 euxassay_016390_07 euxassay_016390_08 euxassay_016390_09
EMAGE:6438 EMAGE:6438 EMAGE:6438 EMAGE:6438 EMAGE:6438
euxassay_016390_10 euxassay_016390_11 euxassay_016390_12 euxassay_016390_13 euxassay_016390_14
EMAGE:6438 EMAGE:6438 EMAGE:6438 EMAGE:6438 EMAGE:6438
euxassay_016390_15 euxassay_016390_16 euxassay_016390_17 euxassay_016390_18 euxassay_016390_19
EMAGE:6438 EMAGE:6438 EMAGE:6438 EMAGE:6438 EMAGE:6438
euxassay_016390_20 euxassay_016390_21 euxassay_016390_22 euxassay_016390_23 euxassay_016390_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6438Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6438_wholemount_strong.wlz
6438_wholemount_moderate.wlz
6438_wholemount_weak.wlz
6438_wholemount_possible.wlz
6438_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6438_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
weak weak
single cellweak expression: see section 09 10 16 17
facial vii ganglion
weak weak
single cellweak expression: see section 20 21
glossopharyngeal ix ganglion
weak weak
single cellweak expression: see section 18 19
trigeminal v ganglion
weak weak
single cellweak expression: see section 09 17 18 19 20 21 22
ventral grey horn
moderate moderate
single cellmoderate expression: see section 13 14 15 weak expression: see section 11
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 17 18 19 weak expression: see section 07 08 09 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45494
Entity Detected:Dnase2b, deoxyribonuclease II beta ( MGI:1913283)
Sequence:sense strand is shown

>T45494
AGTAATAGCACCAGGGGACAGAATACAATATTTTCCTCCAGTTTAATTACCTTCAGTGGTCTGTCTTGTG
GATTAAGTTTCATCTCTCACAAAGCAACCCTGACTGTCCTGTTTGAAGAAAATAAAGGTGCCCTCCTCCC
CCTCCCCCCTCTTTCATACTCTTTGGCCATATGGGCATATTCCCCATGAAGCCCTCCCCCGCTGGTTTAT
AGTTTAGTCTTGTCACCTTTGCAGGTGCTCCTTGCTGCTAATATATGCTCGAACTGCTTACTTGAGTTCT
CTTGCAGTTTATTTTCAATTTTAATCTACAACAGGGAGATCATATCTAAGCATGATATGAGTCAAGAAAT
CACAAGACTTGTTTGCTTAATAGACTATGGGATGTGGGTTCCGAGTTCAAAAGCTTAAGCAGTCAAGCAA
AAGTCATCAGACAGGGAGTGGGCCCTGGGCTTAGTGACTGTGAAGCGTGCAATCCACACTCACCAACCGC
TCTCTTATTTAATCTTCATATCAGTTCTTTTTAGTGATAAGTGTCCTGGTCCCCATTTTACTGCCAAGTC
AACGGAGGCTTAGAGAACTCCAAACACTTGCCTAGTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 219692. Forward Primer - name:219692_F_exon_Dnase2b, sequence:AGTAATAGCACCAGGGGACAGA; Reverse Primer - name:219692_N_SP6_exon_Dnase2b, sequence:TACTAGGCAAGTGTTTGGAGTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6436 same embryo
 EMAGE:6435 same embryo
 EMAGE:6437 same embryo
 EMAGE:6434 same embryo
 EurExpress:euxassay_016390 same experiment
 MGI:4824361 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS