Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6482

Alpl alkaline phosphatase, liver/bone/kidney ( MGI:87983)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6482 EMAGE:6482 EMAGE:6482 EMAGE:6482 EMAGE:6482
"Pseudo-wholemount" of euxassay_002253. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002253_01 euxassay_002253_02 euxassay_002253_03 euxassay_002253_04
EMAGE:6482 EMAGE:6482 EMAGE:6482 EMAGE:6482 EMAGE:6482
euxassay_002253_05 euxassay_002253_06 euxassay_002253_07 euxassay_002253_08 euxassay_002253_09
EMAGE:6482 EMAGE:6482 EMAGE:6482 EMAGE:6482 EMAGE:6482
euxassay_002253_10 euxassay_002253_11 euxassay_002253_12 euxassay_002253_13 euxassay_002253_14
EMAGE:6482 EMAGE:6482 EMAGE:6482 EMAGE:6482 EMAGE:6482
euxassay_002253_15 euxassay_002253_16 euxassay_002253_17 euxassay_002253_18 euxassay_002253_19
EMAGE:6482 EMAGE:6482 EMAGE:6482 EMAGE:6482 EMAGE:6482
euxassay_002253_20 euxassay_002253_21 euxassay_002253_22 euxassay_002253_23 euxassay_002253_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6482Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6482_wholemount_strong.wlz
6482_wholemount_moderate.wlz
6482_wholemount_weak.wlz
6482_wholemount_possible.wlz
6482_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6482_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 16 17 18 19 20 21 22 23 moderate expression: see section 24 weak expression: see section 08 09 14 15
humerus
strong strong
regionalstrong expression: see section 01 02 03 24 moderate expression: see section 23
femur
strong strong
regionalstrong expression: see section 09 10 11 17 18 21 22 23 moderate expression: see section 24
head mesenchyme
strong strong
regionalstrong expression: see section 02 03 04 05 06 21 22 23 24
nasal septum
strong strong
regionalstrong expression: see section 08 09 10 11 18 19 moderate expression: see section 13 14 15
meckel's cartilage
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22 23
lower jaw incisor
strong strong
regionalstrong expression: see section 10 11 12
lower jaw molar
strong strong
regionalstrong expression: see section 06 07 08 09 17 18 19 20 21
upper jaw incisor
strong strong
regionalstrong expression: see section 10 11 12 15
upper jaw molar
strong strong
regionalstrong expression: see section 06 07 08 09 10 17 18 19 20 21
basisphenoid bone
strong strong
regionalstrong expression: see section 11 16
frontal bone primordium
strong strong
regionalstrong expression: see section 01 02
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 21 22 23 24
clavicle
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 moderate expression: see section 19 20 21 weak expression: see section 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3268
Entity Detected:Alpl, alkaline phosphatase, liver/bone/kidney ( MGI:87983)
Sequence:sense strand is shown

>T3268
TGGCCTCGAGGCNAGATTCGGACGAGGTTCCGGCGTCATGAGCAGAACTACATTCCCCATGTGATGGCGT
ATGCCTCCTGCATTGGGGCCAACCTTGACCACTGTGCCTGGGCCGGCTCTGGGAGCGCACCCTCCCCAGG
GGCCCTGCTGCTTCCACTGGCTGTGCTCTCCCTACGCACCCTGTTCTGAGGGTGCAGGTCCCACAAGCCC
GCAATGGACAGCCAGCTCCCCTCCTTTTGTGGCCCACCACCGGGCAGCCCACACTCAAGGGAGAGGTCCA
GGCAACTTCCAGCAGGAACAGAAGTTCGCTATCTGCCTTGCCTGTATCTGGAATCCTCCATGGGCCAGAT
TCCTGGCTCTGCCTTTATTCCCTAGTTATTGCCCTTTGGCCAGCAGGTTTCTCTCTTGGGCAGGCAAGAC
ACAGACTGCACAGATTCCCAAAGCACCTTATTTTTCTACCAAATATATTCTCCAGACCCTGCAACCTCCA
TGGAACATTCCAGATCTGACCTTCTCTCCTCCATCCCTTCCCTTCCCT
Notes:The probe template was PCR amplified from IMAGE:2780093 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2780093 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6485 same embryo
 EMAGE:6488 same embryo
 EMAGE:6484 same embryo
 EMAGE:6487 same embryo
 EMAGE:6483 same embryo
 EMAGE:6486 same embryo
 EurExpress:euxassay_002253 same experiment
 MGI:4823096 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS