Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6599

2310022B05Rik RIKEN cDNA 2310022B05 gene ( MGI:1916801)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6599 EMAGE:6599 EMAGE:6599 EMAGE:6599 EMAGE:6599
"Pseudo-wholemount" of euxassay_016413. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016413_01 euxassay_016413_02 euxassay_016413_03 euxassay_016413_04
EMAGE:6599 EMAGE:6599 EMAGE:6599 EMAGE:6599 EMAGE:6599
euxassay_016413_05 euxassay_016413_06 euxassay_016413_07 euxassay_016413_08 euxassay_016413_09
EMAGE:6599 EMAGE:6599 EMAGE:6599 EMAGE:6599 EMAGE:6599
euxassay_016413_10 euxassay_016413_11 euxassay_016413_12 euxassay_016413_13 euxassay_016413_14
EMAGE:6599 EMAGE:6599 EMAGE:6599 EMAGE:6599 EMAGE:6599
euxassay_016413_15 euxassay_016413_16 euxassay_016413_17 euxassay_016413_18 euxassay_016413_19
EMAGE:6599 EMAGE:6599 EMAGE:6599 EMAGE:6599
euxassay_016413_20 euxassay_016413_21 euxassay_016413_22 euxassay_016413_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6599Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6599_wholemount_strong.wlz
6599_wholemount_moderate.wlz
6599_wholemount_weak.wlz
6599_wholemount_possible.wlz
6599_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6599_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 12 13 weak expression: see section 11
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 05 19 20 moderate expression: see section 03 04 06 21
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 10 13 14 weak expression: see section 11
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 10 12 13 14 15 16 weak expression: see section 11
ventral grey horn
moderate moderate
single cellmoderate expression: see section 10 11 12 13 14 15
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 06 07 08 09 12 13 14 15 16 17
neural retina
weak weak
regionalweak expression: see section 01 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63285
Entity Detected:2310022B05Rik, RIKEN cDNA 2310022B05 gene ( MGI:1916801)
Sequence:sense strand is shown

>T63285
AGGGCTCTTCTGATTCACTGAGGTAGAACCCCAGGCTTAAGCGTCATTCATCCCAGTCTGGTCTGGCTGC
ATCGTGCAGGACACGCCCCCAGACCTGACCGCATTCCTGGTGGTTCCGGAAGCTTCCCCTTGCAGCCCCA
AGAGCTCACAGCAACAAGGCTGGGCGAGGAGTGTGTGCCTCACCCGGAGTTTGATGCCCTCTGTCCTCAC
TGCCCTGACATGGCCTCTGGACCCTCCATGCACCTACAGGATGCTAAGCAAATCTGTGAGCTCGGGGTGG
TGTGGTCTACCCTTTGCTATCACTCCGTTCTCCTCACCCGAAGCCTTAATCTCCACGAGCACTCCTCCGA
GAGCCTGGTTTCAGTACTGCAAGCTGTAGCCTCCTTAATGTCTGAAGTAGCTTCTGGAATATTCTATGTA
GCTCCAAGGTAAAGCACGTGGCAACCCCACCCTCACCCCCCCCCCCCGGCCACTCTCCCCTCCTCTAGGA
AGACATGCCAAAGCTGTATACTTAGCCAATATCGATGTGATACCTGCCAATTAGCTTGTGTCCCGAACCT
CCCTCGGTCCCAGTCCCTGGTGGTGCTGGGGTTTGCCTTCCTCTAGCAACTTTTGATGGAGTCATCTTTC
CGCACTGTTTGTAGGGGAGTTGATACAGAGGAAGAGTTGAAACCTGTGCAACAATGTTTTTCCTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 143665. Forward Primer - name:143665_F_cDNA_2310022B05Rik, sequence:AGGGCTCTTCTGATTCACTGAG; Reverse Primer - name:143665_N_SP6_cDNA_2310022B05Rik, sequence:GGAGGAAAAACATTGTTGCACAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6603 same embryo
 EMAGE:6602 same embryo
 EMAGE:6601 same embryo
 EMAGE:6600 same embryo
 EurExpress:euxassay_016413 same experiment
 MGI:4822662 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS