Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6603

Kif26b kinesin family member 26B ( MGI:2447076)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6603 EMAGE:6603 EMAGE:6603 EMAGE:6603 EMAGE:6603
"Pseudo-wholemount" of euxassay_016415. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016415_01 euxassay_016415_02 euxassay_016415_03 euxassay_016415_04
EMAGE:6603 EMAGE:6603 EMAGE:6603 EMAGE:6603 EMAGE:6603
euxassay_016415_05 euxassay_016415_06 euxassay_016415_07 euxassay_016415_08 euxassay_016415_09
EMAGE:6603 EMAGE:6603 EMAGE:6603 EMAGE:6603 EMAGE:6603
euxassay_016415_10 euxassay_016415_11 euxassay_016415_12 euxassay_016415_13 euxassay_016415_14
EMAGE:6603 EMAGE:6603 EMAGE:6603 EMAGE:6603 EMAGE:6603
euxassay_016415_15 euxassay_016415_16 euxassay_016415_17 euxassay_016415_18 euxassay_016415_19
EMAGE:6603 EMAGE:6603 EMAGE:6603
euxassay_016415_20 euxassay_016415_21 euxassay_016415_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6603Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6603_wholemount_strong.wlz
6603_wholemount_moderate.wlz
6603_wholemount_weak.wlz
6603_wholemount_possible.wlz
6603_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6603_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
interdigital region between hindlimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 03 16 17 weak expression: see section 01 18 19
interdigital region between hindlimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 03 16 17 weak expression: see section 01 18 19
interdigital region between hindlimb digits 3 and 4
moderate moderate
regionalmoderate expression: see section 16 17 weak expression: see section 01 18 19
interdigital region between hindlimb digits 4 and 5
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 18
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 22
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 14 15
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 07 09 10 14 15 16 17 18 19
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 02 03 04 07 15 16 17 18 19 20 21 weak expression: see section 06
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 11 weak expression: see section 12 13 14
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 07 15 16 17 weak expression: see section 08 13 14
extrinsic ocular muscle
weak weak
regionalweak expression: see section 01 02 03 17 18 19 20 21
nasal septum
weak weak
regionalweak expression: see section 08 09 10 11 12 13
metanephros
weak weak
regionalweak expression: see section 07 14 15 16 17
genital tubercle of male
weak weak
regionalweak expression: see section 07 08 09 10 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63292
Entity Detected:Kif26b, kinesin family member 26B ( MGI:2447076)
Sequence:sense strand is shown

>T63292
GAGCTACAAGCAAGGAGGTCATGTGCTTCAATGCCAAGCTGAAAATCCTAGAACATCGGCAGCAGAGAAT
CGCTGAAGTCCGAGCCAAGTACGAGTGGCTGATGAAGGAGCTAGAAGCGACCAGGCAGTACCTGATGCTG
GACCCCAACAAGTGGCTTCGTGAATTTGACTTGGAGCAGGTCCTGCAGCTGGATTCCCTGGAGTACCTGG
AGGCACTGGAGGGTGTGACAGAGCGCTTGGAGAGCCGCGTCAACTTCTGCAAGGCCCATCTCATGATGAT
CACCTGCTTTGACATCACCTCCAGGCGCCGATAAGGACTGATGGGCTCTGAGCCATCAGGCCCTCTCTCC
CCCAGGACTTCAGCAGGACACCGCCCTCCCAAGCCCTCTGTGCTGGCAACACCCAAGACAACAGGATGAG
GATGAAGGTTGGTAGCAAGTCTGGAGTGAGCGTGGAGCGAAAGGCGATGTTTCCTTTGTTTGCCATAGGA
AAGAAAGGTACAGACACCAACATGTGGAAGGAGGAAATGATGGGAAGCCCCGTGGGACTGAGAAAGCACT
TTGAGGAACCTTGAAGAACTCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 105777. Forward Primer - name:105777_F_cDNA_4832420M10, sequence:GAGCTACAAGCAAGGAGGTCAT; Reverse Primer - name:105777_N_SP6_cDNA_4832420M10, sequence:CAGAGTTCTTCAAGGTTCCTCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6599 same embryo
 EMAGE:6602 same embryo
 EMAGE:6601 same embryo
 EMAGE:6600 same embryo
 EurExpress:euxassay_016415 same experiment
 MGI:4825760 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS