Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6616

Mir296 microRNA 296 ( MGI:3619269)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6616 EMAGE:6616 EMAGE:6616 EMAGE:6616 EMAGE:6616
"Pseudo-wholemount" of euxassay_019068. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019068_01 euxassay_019068_02 euxassay_019068_03 euxassay_019068_04
EMAGE:6616 EMAGE:6616 EMAGE:6616 EMAGE:6616 EMAGE:6616
euxassay_019068_05 euxassay_019068_06 euxassay_019068_07 euxassay_019068_08 euxassay_019068_09
EMAGE:6616 EMAGE:6616 EMAGE:6616 EMAGE:6616 EMAGE:6616
euxassay_019068_10 euxassay_019068_11 euxassay_019068_12 euxassay_019068_13 euxassay_019068_14
EMAGE:6616 EMAGE:6616 EMAGE:6616 EMAGE:6616 EMAGE:6616
euxassay_019068_15 euxassay_019068_16 euxassay_019068_17 euxassay_019068_18 euxassay_019068_19
EMAGE:6616 EMAGE:6616 EMAGE:6616 EMAGE:6616 EMAGE:6616
euxassay_019068_20 euxassay_019068_21 euxassay_019068_22 euxassay_019068_23 euxassay_019068_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6616Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6616_wholemount_strong.wlz
6616_wholemount_moderate.wlz
6616_wholemount_weak.wlz
6616_wholemount_possible.wlz
6616_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6616_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 weak expression: see section 16 21 22
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 07 09 10 11 12 14 15 24 weak expression: see section 21 22 23
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 14 15 16
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 15
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 15 16 weak expression: see section 04 05 06
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 weak expression: see section 06
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 05 06 weak expression: see section 20
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 07 weak expression: see section 08 18
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 08 21 22 weak expression: see section 09 18 19 20
vestibulocochlear viii ganglion
weak weak
single cellweak expression: see section 08
trigeminal v nerve
weak weak
single cellweak expression: see section 09
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 14 15 16 17 18
neural retina
weak weak
regionalweak expression: see section 01 02 03 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70371
Entity Detected:Mir296, microRNA 296 ( MGI:3619269)
Sequence:sense strand is shown

>T70371
GAGGGTTGGGTGGAGGCTCTCC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-296-3p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6617 same embryo
 EMAGE:6615 same embryo
 EMAGE:6618 same embryo
 EurExpress:euxassay_019068 same experiment
 MGI:4826256 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS