Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6637

Arl4a ADP-ribosylation factor-like 4A ( MGI:99437)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6637 EMAGE:6637 EMAGE:6637 EMAGE:6637 EMAGE:6637
"Pseudo-wholemount" of euxassay_007257. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007257_01 euxassay_007257_02 euxassay_007257_03 euxassay_007257_04
EMAGE:6637 EMAGE:6637 EMAGE:6637 EMAGE:6637 EMAGE:6637
euxassay_007257_05 euxassay_007257_06 euxassay_007257_07 euxassay_007257_08 euxassay_007257_09
EMAGE:6637 EMAGE:6637 EMAGE:6637 EMAGE:6637 EMAGE:6637
euxassay_007257_10 euxassay_007257_11 euxassay_007257_12 euxassay_007257_13 euxassay_007257_14
EMAGE:6637 EMAGE:6637 EMAGE:6637 EMAGE:6637 EMAGE:6637
euxassay_007257_15 euxassay_007257_16 euxassay_007257_17 euxassay_007257_18 euxassay_007257_19
EMAGE:6637 EMAGE:6637 EMAGE:6637 EMAGE:6637
euxassay_007257_20 euxassay_007257_21 euxassay_007257_22 euxassay_007257_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6637Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6637_wholemount_strong.wlz
6637_wholemount_moderate.wlz
6637_wholemount_weak.wlz
6637_wholemount_possible.wlz
6637_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6637_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
spottedweak expression: see section 02 03 04 05 06 07 08 09 10 15 16 18 19
diencephalon meninges
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
thalamus mantle layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17 18
telencephalon meninges
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
hindbrain meninges
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain meninges
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
spinal cord meninges
weak weak
regionalweak expression: see section 10 11 12 13 14 15
esophagus
weak weak
regionalweak expression: see section 12
mandible
moderate moderate
regionalmoderate expression: see section 04 06 07 08 09 16 17 18 weak expression: see section 05 19
maxilla
moderate moderate
regionalmoderate expression: see section 04 06 07 08 09 16 17 18 weak expression: see section 05 19
urethra of male
moderate moderate
regionalmoderate expression: see section 12 13
lung
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2061
Entity Detected:Arl4a, ADP-ribosylation factor-like 4A ( MGI:99437)
Sequence:sense strand is shown

>T2061
TGGCCTCGAGGCCAGATTCGGCACGAGGGTTCCTGTATTGGAAATGAGTTGGTTTATACAAAGTATTAAT
TGGGTTAAACATTCTAATTTAAAATTACTACTAGCAAGCAAAGTTTTAAAATATCCTTTGATACTTAAAG
AGTCATATATCCAAACTTATGCTAAAATAGATTATAAATGTTATGGTTTAGCCTAGATAAATTCATTAAT
AATCATAAAATCCTTACAGGAAGCTAAAAACTGCAGTGTTAGGATATGTAGATGGAAGTCAATGACTACT
AGTCTGTAGGTAACTGGATGATAGCTTAAGAATGAGAGTAAAGGGCACATAATTAGAATGTTTTGGTACG
AGTTGGGATTATGGGTACAATGGGTGCTTGCCTATCAGGTACAGGGCTCTGGGTTTGAGTGCTAGCACTG
CAAAGGAAAAATAAATCACTTACCAGAATGGCTTGTTTAGAAGAGTTTAATTGTTTATAGTGGCCATGAG
AGAAATCTGGTATAGTGTATCAGTGTTCTATTTAATGTAATGGTTTTATCATATAAA
Notes:The probe template was PCR amplified from IMAGE:820282 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:820282 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6636 same embryo
 EMAGE:6638 same embryo
 EMAGE:6639 same embryo
 EMAGE:6640 same embryo
 EMAGE:6635 same embryo
 EurExpress:euxassay_007257 same experiment
 MGI:4823238 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS