Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6694

Tap1 transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) ( MGI:98483)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6694 EMAGE:6694 EMAGE:6694 EMAGE:6694 EMAGE:6694
"Pseudo-wholemount" of euxassay_007322. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007322_01 euxassay_007322_02 euxassay_007322_03 euxassay_007322_04
EMAGE:6694 EMAGE:6694 EMAGE:6694 EMAGE:6694 EMAGE:6694
euxassay_007322_05 euxassay_007322_06 euxassay_007322_07 euxassay_007322_08 euxassay_007322_09
EMAGE:6694 EMAGE:6694 EMAGE:6694 EMAGE:6694 EMAGE:6694
euxassay_007322_10 euxassay_007322_11 euxassay_007322_12 euxassay_007322_13 euxassay_007322_14
EMAGE:6694 EMAGE:6694 EMAGE:6694 EMAGE:6694 EMAGE:6694
euxassay_007322_15 euxassay_007322_16 euxassay_007322_17 euxassay_007322_18 euxassay_007322_19
EMAGE:6694 EMAGE:6694 EMAGE:6694 EMAGE:6694 EMAGE:6694
euxassay_007322_20 euxassay_007322_21 euxassay_007322_22 euxassay_007322_23 euxassay_007322_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6694Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6694_wholemount_strong.wlz
6694_wholemount_moderate.wlz
6694_wholemount_weak.wlz
6694_wholemount_possible.wlz
6694_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6694_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 weak expression: see section 03 04 05 06 07 08 09 10 11 19 20
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 17 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 17 18 19 20
vagus x ganglion
weak weak
regionalweak expression: see section 07 08 17
spinal cord
moderate moderate
regionalmoderate expression: see section 12 13 14 weak expression: see section 08 09 10 11
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1883
Entity Detected:Tap1, transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) ( MGI:98483)
Sequence:sense strand is shown

>T1883
TGGCCTCGAGCCAGATTCGGACGAGGGAGCCTTGATCCGGAAGCCACTCCTGCTTATCTTGGATGATGCC
ACCAGTGCCCTGGATGCTGGCAACCAGCTACGGGTCCAGCGGCTCCTGTATGAGAGCCCCAAGCGGGCTT
CTCGGACGGTTCTTCTTATCACCCAGCAGCTCAGCCTGGCAGAGCAGGCCCACCACATCCTCTTTCTCAG
AGAAGGCTCTGTCGGCGAGCAGGGCACCCACCTGCAGCTCATGAAGAGAGGAGGGTGCTACCGGGCCATG
GTAGAGGCTCTTGCGGCTCCTGCAGACTGACAAGGCCTCTGGACTGCACACTGCGTGCTGTCCCCCTCCT
GTCCTCTACTCTGTGTGACAGAGAACCTGGGAGCAAAGATATTACCACACCCACGGAGACAGTTGAGGAG
CGGAGGTGCTTGTTACATGAGAAAATGTAAACTCTAGGAGATACCCGGAATTTACCACGAATGTGTTTCC
CCGACCCGCTCCCTATTAGACGGGGTTTCAGGTACCTCACACCAACACTG
Notes:The probe template was PCR amplified from IMAGE:597306 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:597306 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6696 same embryo
 EMAGE:6697 same embryo
 EMAGE:6693 same embryo
 EMAGE:6695 same embryo
 EMAGE:6698 same embryo
 EurExpress:euxassay_007322 same experiment
 MGI:4828598 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS