EMAGE mouse gene expression spatial database

EMAGE:6733

Csf1 colony stimulating factor 1 (macrophage) ( MGI:1339753)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_002344. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_002344_01	euxassay_002344_02	euxassay_002344_03	euxassay_002344_04

euxassay_002344_05	euxassay_002344_06	euxassay_002344_07	euxassay_002344_08	euxassay_002344_09

euxassay_002344_10	euxassay_002344_11	euxassay_002344_12	euxassay_002344_13	euxassay_002344_14

euxassay_002344_15	euxassay_002344_16	euxassay_002344_17	euxassay_002344_18	euxassay_002344_19

euxassay_002344_20	euxassay_002344_21	euxassay_002344_22	euxassay_002344_23	euxassay_002344_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T1922
Entity Detected:	Csf1, colony stimulating factor 1 (macrophage) ( MGI:1339753)
Sequence:	sense strand is shown >T1922 TGGCCTCGAGGCCAGATTCGGACGAGGGGAAAACACAGAAACAAACAAAACAAGGCATTCTCTACCCCTC CACCTTAAACATATATTATTAAAGACAGAAGAGAAAATCCAACCCATTGCAAGAAGCTCTTTGTGGGTGC CTGGTTACATCGGAGCAGGGGAGCCTCAAATCCACCTTTGGAGCCGCCCCTGTGTGCATTAGGAACCCTT CTCTCCTCTGAGAAAGCTCAGAGGGAGCACTGCCTCACAAACTGTGAGACTGCGTTTTTTATACTTGGAA GTGGTGAATTATTTTATATAAGGTCATTTAAATATCTATTTAAAAAATAGGAAGCTGCTTTTATATTTAA TAATAAAAGAAGTGCACAAGCAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:634838 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:634838 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:6736 same embryo
	EMAGE:6734 same embryo
	EMAGE:6732 same embryo
	EMAGE:6731 same embryo
	EMAGE:6735 same embryo
	EurExpress:euxassay_002344 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source