Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6879

Fbln5 fibulin 5 ( MGI:1346091)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6879 EMAGE:6879 EMAGE:6879 EMAGE:6879 EMAGE:6879
"Pseudo-wholemount" of euxassay_002515. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002515_01 euxassay_002515_02 euxassay_002515_03 euxassay_002515_04
EMAGE:6879 EMAGE:6879 EMAGE:6879 EMAGE:6879 EMAGE:6879
euxassay_002515_05 euxassay_002515_06 euxassay_002515_07 euxassay_002515_08 euxassay_002515_09
EMAGE:6879 EMAGE:6879 EMAGE:6879 EMAGE:6879 EMAGE:6879
euxassay_002515_10 euxassay_002515_11 euxassay_002515_12 euxassay_002515_13 euxassay_002515_14
EMAGE:6879 EMAGE:6879 EMAGE:6879 EMAGE:6879 EMAGE:6879
euxassay_002515_15 euxassay_002515_16 euxassay_002515_17 euxassay_002515_18 euxassay_002515_19
EMAGE:6879 EMAGE:6879 EMAGE:6879 EMAGE:6879 EMAGE:6879
euxassay_002515_20 euxassay_002515_21 euxassay_002515_22 euxassay_002515_23 euxassay_002515_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6879Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6879_wholemount_strong.wlz
6879_wholemount_moderate.wlz
6879_wholemount_weak.wlz
6879_wholemount_possible.wlz
6879_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6879_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23
diaphragm
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 weak expression: see section 03 04 05 06 07 08 09 20 21 22 23
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 19 20 21 22 23 24
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 16 17 18 19 20
leg
moderate moderate
regionalmoderate expression: see section 01 19 20 21 22 23 24
head mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 15 16 17 18 19 20 21 22 23 24
body-wall mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 15 16 17 18 19 20 21 22 23 24
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 19 20
aorta
strong strong
regionalstrong expression: see section 12 13 14 15
esophagus
strong strong
regionalstrong expression: see section 10 11 12 13
tongue
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
lower lip
weak weak
regionalweak expression: see section 05 07 08 11 12 13 14 15 16 17 18 19 20
mandible
moderate moderate
regionalmoderate expression: see section 05 06 07 08 11 12 13 14 15 16
upper lip
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
maxilla
moderate moderate
regionalmoderate expression: see section 05 11 12 13 14 15 16
premaxilla
moderate moderate
regionalmoderate expression: see section 06 07 08
axial skeleton cervical region
moderate moderate
regionalmoderate expression: see section 08 11 12 13 14 15
axial skeleton lumbar region
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
axial skeleton sacral region
moderate moderate
regionalmoderate expression: see section 08 09 12 13
axial skeleton thoracic region
moderate moderate
regionalmoderate expression: see section 08 10 11 12 13 14 15
cranium
strong strong
regionalstrong expression: see section 01 02 03 04 moderate expression: see section 05 22 23 24 weak expression: see section 06 07 08 09 10 11 12 19 20 21
clavicle
moderate moderate
spottedmoderate expression: see section 07 08 09 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3044
Entity Detected:Fbln5, fibulin 5 ( MGI:1346091)
Sequence:sense strand is shown

>T3044
TGNCCTCGAGNCAGATTCGTCGACATCGGCCTATCAGTGCCACCCTGGTGATGACACGCCCCATCAAAGG
GCCTCGGGACATCCAGCTGGACTTGGAGATGATCACTGTCAACACTGTCATCAACTTCAGAGGCAGCTCC
GTGATCCGACTGCGGATATATGTGTCGCAGTATCCGTTCTGAGCCTCTGGCTAAGGCCTCTGACACTGCC
TTTCACCAGCACCGAGGGACGGGAGGAGAAAGGAAACCAGCAAGAATGAGAGCGAGACAGACATTGCACC
TTTCCTGCTGAATATCTCCTGGGGGCATCAGCCTAGCATCTTGACCCATATCTGTACTATTGCAGATGGT
CACTCTGAAGGACACCCTGCCCTCAGTTCCTATGATGCAGTTATCCAAAAGTGTTCATCTTAGCCCCTGA
TATGAGGTTGCCAGTGACTCTTCAAAGCCTTCCATTTATTTCCATCGTTTTATAAAAAAGAAAATAGATT
AGATTTGCTGGGGTATGAGTCCTCGAAGGTTCAAAAGACTGAGTGGCTTGCTCTCACCT
Notes:The probe template was PCR amplified from IMAGE:1546076 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1546076 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6882 same embryo
 EMAGE:6881 same embryo
 EMAGE:6878 same embryo
 EMAGE:6880 same embryo
 EurExpress:euxassay_002515 same experiment
 MGI:4824790 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS