Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7070

Soat2 sterol O-acyltransferase 2 ( MGI:1332226)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7070 EMAGE:7070 EMAGE:7070 EMAGE:7070 EMAGE:7070
euxassay_002388_01 euxassay_002388_02 euxassay_002388_03 euxassay_002388_04 euxassay_002388_05
EMAGE:7070 EMAGE:7070 EMAGE:7070 EMAGE:7070 EMAGE:7070
euxassay_002388_06 euxassay_002388_07 euxassay_002388_08 euxassay_002388_09 euxassay_002388_10
EMAGE:7070 EMAGE:7070 EMAGE:7070 EMAGE:7070 EMAGE:7070
euxassay_002388_11 euxassay_002388_12 euxassay_002388_13 euxassay_002388_14 euxassay_002388_15
EMAGE:7070 EMAGE:7070 EMAGE:7070 EMAGE:7070 EMAGE:7070
euxassay_002388_16 euxassay_002388_17 euxassay_002388_18 euxassay_002388_19 euxassay_002388_20
EMAGE:7070 EMAGE:7070 EMAGE:7070
euxassay_002388_21 euxassay_002388_22 euxassay_002388_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7070Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7070_wholemount_strong.wlz
7070_wholemount_moderate.wlz
7070_wholemount_weak.wlz
7070_wholemount_possible.wlz
7070_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7070_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1975
Entity Detected:Soat2, sterol O-acyltransferase 2 ( MGI:1332226)
Sequence:sense strand is shown

>T1975
CACTNGCTCANTATGGTGTGACTCGAGCACCTACCCTCTGTGGACTGGGCACAGGTTCCCTTCATGTCTC
TCCAAGTGTGCGGAGACTCAGAGGAACAGGGCACACCAAAGTCTGACACGTTTGGTTCTTTCTGCTTCTC
CCAATGCAACAATAAAAATCTTAGTCTCGGACTGGAGAGATGGCTCAGTGGTTAAGAGCACTGAGTGCTC
TTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAGCCATCTGAAATGGGATCTGAT
GCCCTCTTCTGGTGTGTCTGAAGACAGCGACAGTGTACTCACATACATTAAATAAATAAATCTTGAACAT
AAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:643293 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:643293 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7071 same embryo
 EMAGE:7067 same embryo
 EMAGE:7066 same embryo
 EMAGE:7069 same embryo
 EMAGE:7068 same embryo
 EurExpress:euxassay_002388 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS