EMAGE mouse gene expression spatial database

EMAGE:7170

Hoxa4 homeobox A4 ( MGI:96176)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_002599. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_002599_01	euxassay_002599_02	euxassay_002599_03	euxassay_002599_04

euxassay_002599_05	euxassay_002599_06	euxassay_002599_07	euxassay_002599_08	euxassay_002599_09

euxassay_002599_10	euxassay_002599_11	euxassay_002599_12	euxassay_002599_13	euxassay_002599_14

euxassay_002599_15	euxassay_002599_16	euxassay_002599_17	euxassay_002599_18	euxassay_002599_19

euxassay_002599_20	euxassay_002599_21	euxassay_002599_22

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

spinal cord

strong

homogeneous

strong expression: see section 18 moderate expression: see section 07 08 09 10 11 12 weak expression: see section 13 14 15 16 17

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T5360
Entity Detected:	Hoxa4, homeobox A4 ( MGI:96176)
Sequence:	sense strand is shown >T5360 AAGCGCTCTCGAACCGCCTATACCCGGCAGCAAGTCTTGGAACTGGAGAAGGAATTCCACTTTAACCGCT ACCTGACCCGGCGGCGCCGCATCGAGATCGCCCACACGCTCTGCTTGTCGGAGCGCCAGGTCAAGATCTG GTTTCAGAACCGGAGAATGAAGTGGAAGAAAGACCACAAACTTCCCAACACCAAGATGCGATCTTCCAAC ACTGCCTCGGCCCCTGCCGGCCCGCCTGGGAAAGCACAAACTCACAGCCCACACCCCCATCCCCACCCTC TCCCTGGTGCTTCCACACCCATTCCCTCCTCCATATAACTATGG
Notes:	The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:CCTGGATGAAGAAGATCCAC; Reverse Primer - name:unspecified, sequence:TTATATGGAGGAGGGAATGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:7168 same embryo
	EMAGE:7172 same embryo
	EMAGE:7169 same embryo
	EMAGE:7167 same embryo
	EMAGE:7171 same embryo
	EurExpress:euxassay_002599 same experiment
	MGI:4825417 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source