Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7687

Ppp1r1c protein phosphatase 1, regulatory (inhibitor) subunit 1C ( MGI:1923185)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7687 EMAGE:7687 EMAGE:7687 EMAGE:7687 EMAGE:7687
"Pseudo-wholemount" of euxassay_009513. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009513_01 euxassay_009513_02 euxassay_009513_03 euxassay_009513_04
EMAGE:7687 EMAGE:7687 EMAGE:7687 EMAGE:7687 EMAGE:7687
euxassay_009513_05 euxassay_009513_06 euxassay_009513_07 euxassay_009513_08 euxassay_009513_09
EMAGE:7687 EMAGE:7687 EMAGE:7687 EMAGE:7687 EMAGE:7687
euxassay_009513_10 euxassay_009513_11 euxassay_009513_12 euxassay_009513_13 euxassay_009513_14
EMAGE:7687 EMAGE:7687 EMAGE:7687 EMAGE:7687 EMAGE:7687
euxassay_009513_15 euxassay_009513_16 euxassay_009513_17 euxassay_009513_18 euxassay_009513_19
EMAGE:7687 EMAGE:7687 EMAGE:7687 EMAGE:7687 EMAGE:7687
euxassay_009513_20 euxassay_009513_21 euxassay_009513_22 euxassay_009513_23 euxassay_009513_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7687Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7687_wholemount_strong.wlz
7687_wholemount_moderate.wlz
7687_wholemount_weak.wlz
7687_wholemount_possible.wlz
7687_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7687_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 15 weak expression: see section 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 18
facial vii ganglion
strong strong
regionalstrong expression: see section 21 22 moderate expression: see section 04 20 weak expression: see section 05
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 18 19 moderate expression: see section 06 07
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 05 18 19 21 22 moderate expression: see section 04 06 07 08 09 17 20
vagus x ganglion
strong strong
regionalstrong expression: see section 18 19 moderate expression: see section 07 08 17
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 05 06 07 08 17 18 19
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 12 13 14 15 16 17 moderate expression: see section 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36886
Entity Detected:Ppp1r1c, protein phosphatase 1, regulatory (inhibitor) subunit 1C ( MGI:1923185)
Sequence:sense strand is shown

>T36886
CTGCCACATGAATGTTCTCACTTTGATACTGCCAAAGCTTAAGTCCTCCTGGCCTACGACATAATTTACA
TTCTAAGGTCAAATGTAGAGAGCATTACAAAATAAATAGCAAATGTGTGTGGGACGAGTGTGAGTGGGGA
TTAATGGAAGACGGGCATCTGCGGAGGCTCCTAAGTAATAACCGCACTTAGCAAGCTTCTGTGCCCTACA
TCAGACCCCAGTTTACCTCAAGGAGACAGTGATAGGCAGACATCTGTTGTCTGGCTTCAAAACACCACAT
CAGATGTTACATGATTTCCATCCAGCAGTTACTTAAAGAAACAAATGTCCCTTTATTTTCTAAGCCATTC
AATGTTGGCTTCTCAGCATCATCTAGTTATTGGAAAGGAAATGTTAAATTTGTAAGTAAACATAGCCATT
CTCTTCTGCCTTTTCTTTATTATTATTTTTTAACTATTTAAAACGAAGCCATCTATATTGTATCACTTTT
GTTTGTCTGGGTTTTTCATTGTTTCTTTCTGTTTTATTGGTGCTAGAGAATGAACCCAGGGCTTTGTATA
TGCAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 70157. Forward Primer - name:070157_F_cDNA_Ppp1r1c, sequence:CTGCCACATGAATGTTCTCACT; Reverse Primer - name:070157_N_SP6_cDNA_Ppp1r1c, sequence:TTGCATATACAAAGCCCTGGGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7684 same embryo
 EMAGE:7683 same embryo
 EMAGE:7685 same embryo
 EMAGE:7686 same embryo
 EMAGE:7682 same embryo
 EurExpress:euxassay_009513 same experiment
 MGI:4827374 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS