Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7738

Cartpt CART prepropeptide ( MGI:1351330)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7738 EMAGE:7738 EMAGE:7738 EMAGE:7738 EMAGE:7738
"Pseudo-wholemount" of euxassay_007423. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007423_01 euxassay_007423_02 euxassay_007423_03 euxassay_007423_04
EMAGE:7738 EMAGE:7738 EMAGE:7738 EMAGE:7738 EMAGE:7738
euxassay_007423_05 euxassay_007423_06 euxassay_007423_07 euxassay_007423_08 euxassay_007423_09
EMAGE:7738 EMAGE:7738 EMAGE:7738 EMAGE:7738 EMAGE:7738
euxassay_007423_10 euxassay_007423_11 euxassay_007423_12 euxassay_007423_13 euxassay_007423_14
EMAGE:7738 EMAGE:7738 EMAGE:7738 EMAGE:7738 EMAGE:7738
euxassay_007423_15 euxassay_007423_16 euxassay_007423_17 euxassay_007423_18 euxassay_007423_19
EMAGE:7738 EMAGE:7738 EMAGE:7738 EMAGE:7738 EMAGE:7738
euxassay_007423_20 euxassay_007423_21 euxassay_007423_22 euxassay_007423_23 euxassay_007423_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7738Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7738_wholemount_strong.wlz
7738_wholemount_moderate.wlz
7738_wholemount_weak.wlz
7738_wholemount_possible.wlz
7738_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7738_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 19 20 21 22 23 24 weak expression: see section 08 09 10 11 15 16 18
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 08 11 12 14 moderate expression: see section 07 15 18
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 14 15 16 17 18
pons mantle layer
strong strong
regionalstrong expression: see section 08 18
ventral grey horn
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 moderate expression: see section 17
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11 16 17
cervical ganglion
strong strong
regionalstrong expression: see section 08 09 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 14 15
nasal cavity olfactory epithelium
strong strong
single cellstrong expression: see section 11 12 14 15 16
mandible
moderate moderate
regionalmoderate expression: see section 07 08 09 16 weak expression: see section 03 04 05 06 10 11 15 17 18 19 20 21 22
maxilla
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 10 17 18 19 20 21
left lung
moderate moderate
spottedmoderate expression: see section 03 04 05 06 07 08 09 10 11 12
right lung
moderate moderate
spottedmoderate expression: see section 14 15 16 18 19 20 21 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 22 23 24 weak expression: see section 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T9068
Entity Detected:Cartpt, CART prepropeptide ( MGI:1351330)
Sequence:sense strand is shown

>T9068
CAGAACCATGGAGAGCTCCCGCCTGCGGCTGCTACCCCTCCTGGGCGCCGCCCTGCTGCTACTGCTACCT
TTGCTGGGTGCCCGTGCCCAGGAGGACGCCGAGCTGCAGCCCCGAGCCCTGGACATCTACTCTGCCGTGG
ATGATGCGTCCCACGAGAAGGAGCTGCCAAGGCGGCAACTTCGGGCTCCCGGCGCTATGTTGCAGATCGA
AGCGTTGCAAGAAGTCCTGAAGAAGCTCAAGAGTAAACGCATTCCGATCTACGAGAAGAAGTACGGCCAA
GTCCCCATGTGTGACGCTGGAGAGCAGTGCGCAGTGAGGAAAGGGGCCAGGATCGGGAAGCTGTGTGACT
GTCCCCGAGGAACTTCCTGCAATTCTTTCCTCTTGAAGTGCTTGTGAAGGGACGACAGCCGCCACCTTCG
GTTCCCATATTCCCTCTTTCCCCCAAAGGAGCGCTCCATTATCCCTGGAGCCTGGCTTTAGCAACAATAA
AGTTTGCGTTCCCCTCAGAGAGCGGATGGGCTCTTTCCCTGTTGCTTCAAAATAAAAGATTTGACATCAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:6817832 using vector (pYX-Asc) specific primers. Forward Primer - name:RZPD T3, sequence:ATTAACCCTCACTAAAGGGA; Reverse Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:6817832 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7737 same embryo
 EMAGE:7740 same embryo
 EMAGE:7739 same embryo
 EMAGE:7736 same embryo
 EurExpress:euxassay_007423 same experiment
 MGI:4823638 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS