Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7743

Atxn7 ataxin 7 ( MGI:2179277)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7743 EMAGE:7743 EMAGE:7743 EMAGE:7743 EMAGE:7743
"Pseudo-wholemount" of euxassay_007505. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007505_01 euxassay_007505_02 euxassay_007505_03 euxassay_007505_04
EMAGE:7743 EMAGE:7743 EMAGE:7743 EMAGE:7743 EMAGE:7743
euxassay_007505_05 euxassay_007505_06 euxassay_007505_07 euxassay_007505_08 euxassay_007505_09
EMAGE:7743 EMAGE:7743 EMAGE:7743 EMAGE:7743 EMAGE:7743
euxassay_007505_10 euxassay_007505_11 euxassay_007505_12 euxassay_007505_13 euxassay_007505_14
EMAGE:7743 EMAGE:7743 EMAGE:7743 EMAGE:7743 EMAGE:7743
euxassay_007505_15 euxassay_007505_16 euxassay_007505_17 euxassay_007505_18 euxassay_007505_19
EMAGE:7743 EMAGE:7743 EMAGE:7743 EMAGE:7743 EMAGE:7743
euxassay_007505_20 euxassay_007505_21 euxassay_007505_22 euxassay_007505_23 euxassay_007505_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7743Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7743_wholemount_strong.wlz
7743_wholemount_moderate.wlz
7743_wholemount_weak.wlz
7743_wholemount_possible.wlz
7743_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7743_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
body cavity or lining
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
limb
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
mesenchyme
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
gland
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
alimentary system
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
integumental system
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 13 14 15 16
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 04 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
pons mantle layer
strong strong
regionalstrong expression: see section 04 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 13 14 15 16 17
midbrain ventricular layer
strong strong
regionalstrong expression: see section 12 13
central nervous system ganglion
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
central nervous system nerve
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
spinal cord mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16
peripheral nervous system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
sensory organ system
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
cardiovascular system
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
urinary system
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
reproductive system
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
respiratory system
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
tail
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3332
Entity Detected:Atxn7, ataxin 7 ( MGI:2179277)
Sequence:sense strand is shown

>T3332
TGGCCTCGAGCCAGATTCGGACGAGGTCTGAAGTGGGAGGAACAGCCAAGGCAGGCTTGCTAGATGAGCT
ATGTCTTCTTTCATAGTGAGATTGAAATGCCTGCGGTTTGACAACTTGGTTGCAGTCATTACACACCACC
AAGTAGAAATCATCATGTGCTGGGCAGAGACCAAAGATCGGCATATCTTCCCGGCAGAGCCCCATGACTT
CGCGGTTTTTCCCAAACTCCTTGAAACTTTCATCCAATTCGGTCCCATCCTTCCCAGGAAGTTTGGAAGC
TTCCACCCACAGATTCCACGACTGTCCCAGCATCGCTTCGGGACTGGGCAAGGGCCTGCGCTCCCCAACC
GTCGCCATGGCGGCGGCCGAGGTGGTGGTGTCCCCGGTGCCGCCGTCCTCCGCCCGTGGGCGCCGCAGCG
GCGGGTGCTGCCGCTGGGGCTGCAGAGGCTGTGGCTGCTGCTGCTGCTGCCGG
Notes:The probe template was PCR amplified from IMAGE:314478 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:314478 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7744 same embryo
 EMAGE:7746 same embryo
 EMAGE:7742 same embryo
 EMAGE:7741 same embryo
 EMAGE:7745 same embryo
 EurExpress:euxassay_007505 same experiment
 MGI:4823350 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS